ID: 967926903

View in Genome Browser
Species Human (GRCh38)
Location 3:194657361-194657383
Sequence GTTCCTTTTAAATATGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967926903_967926904 -3 Left 967926903 3:194657361-194657383 CCATTAACATATTTAAAAGGAAC 0: 1
1: 0
2: 2
3: 29
4: 440
Right 967926904 3:194657381-194657403 AACAGTACTCTCCTAAGTTGAGG 0: 1
1: 0
2: 1
3: 7
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967926903 Original CRISPR GTTCCTTTTAAATATGTTAA TGG (reversed) Intronic
900854082 1:5166796-5166818 GTTCATTTTGCATATGTTGATGG - Intergenic
901121111 1:6894782-6894804 GTTCCTTTTAAAAATAGAAATGG + Intronic
901485117 1:9554327-9554349 GTTTCTTTTAAAAATATTCACGG - Intronic
901584712 1:10279498-10279520 GTCCCTTTTAATTCTGTTAATGG + Intronic
902455114 1:16527849-16527871 GTTCCTTTTAAATAAGAGAGTGG - Intergenic
903402935 1:23070497-23070519 GTGTTTTTTAAATATGTAAAAGG - Intronic
903429548 1:23283310-23283332 GTTCCTTTAATAAATGTTGAGGG + Intergenic
903635072 1:24807851-24807873 GTTCATTATAAAAATGTTAATGG + Intronic
905551654 1:38846080-38846102 TTTCTTTTAAAATAGGTTAAAGG - Exonic
906015972 1:42579951-42579973 GTTCCTTTTTAATATATGAGAGG - Intronic
908878359 1:68702987-68703009 TTTGCTTTTGAACATGTTAAGGG - Intergenic
909908203 1:81225281-81225303 TTTACTTTTAAATAAATTAATGG + Intergenic
910772385 1:90843151-90843173 GTTCCTATTTAATATGTTTAAGG + Intergenic
911433356 1:97822486-97822508 GTTCCTGTAAAATTTGTTCAGGG + Intronic
911447838 1:98020853-98020875 GTTACTTTTAAATTTTTCAATGG - Intergenic
912057869 1:105628905-105628927 GTTCATTTTAAGTAGGTTTACGG - Intergenic
912831052 1:112954573-112954595 TTTCCTTTTTAATCTGTTTAAGG + Intronic
913977428 1:143473676-143473698 TTTCCTTTTAAAAATAATAATGG - Intergenic
914071832 1:144299307-144299329 TTTCCTTTTAAAAATAATAATGG - Intergenic
914107323 1:144667049-144667071 TTTCCTTTTAAAAATAATAATGG + Intergenic
915390892 1:155543002-155543024 TTTTTTTTTAAATATTTTAACGG + Intronic
916452835 1:164937670-164937692 GTTCCATGTAAATATCTCAAAGG + Intergenic
916709714 1:167393131-167393153 GTTCTTTTTAAAAATATCAAAGG + Intronic
916964439 1:169921172-169921194 GTTCTTTTTATAAATTTTAAAGG + Intergenic
917332510 1:173896242-173896264 GTTCATTCTTAACATGTTAAGGG + Exonic
918330052 1:183450518-183450540 ATTCCTTTTAATTTTGTTTATGG + Intergenic
918641314 1:186844514-186844536 TCTACTTTTAAAAATGTTAATGG + Intronic
918937365 1:190939870-190939892 GTGCCTTTTCACTCTGTTAATGG + Intergenic
919439444 1:197612151-197612173 CTTAATTTTAAATATATTAATGG - Intronic
921305743 1:213794821-213794843 CTTCCAATTAAATAGGTTAAAGG - Intergenic
921375988 1:214474407-214474429 GTCTCTTTGAAATCTGTTAAGGG - Intronic
921568912 1:216755043-216755065 GTTCTTTGTAAATGTGTTCATGG - Intronic
922990273 1:229901855-229901877 CTTCCCTTTAAGTATGTAAAAGG - Intergenic
923733807 1:236581906-236581928 GTTATTTTTAAATATAGTAATGG + Intronic
1065384287 10:25118357-25118379 CTTCCTTTTACAGATGCTAAAGG + Intergenic
1066082302 10:31943578-31943600 GTTTCTATTAAAGATGATAAGGG + Intergenic
1066979137 10:42395770-42395792 TTTCCTTTTAAAGATGTTGTAGG + Intergenic
1067516613 10:46952448-46952470 TTTTCTTTTAAAAATATTAAAGG - Intronic
1067645638 10:48099345-48099367 TTTTCTTTTAAAAATATTAAAGG + Intergenic
1068365908 10:56049768-56049790 GATCCTTAAAAATATGTTATGGG + Intergenic
1068370059 10:56101782-56101804 CTTAATTTTAAATATTTTAAAGG + Intergenic
1068782338 10:60934342-60934364 GTTCCTTTGATATAAGTAAAGGG - Intronic
1068926788 10:62548492-62548514 GTTTCTTTAAAATATATGAATGG - Intronic
1069068248 10:63968385-63968407 GTTCCTTTTCAATATAGTACTGG + Intergenic
1069111870 10:64457388-64457410 ATTACTTTTGAATATGTTGATGG - Intergenic
1069215909 10:65820728-65820750 GATCCTTTTAAATTTATTGAGGG + Intergenic
1070111831 10:73494676-73494698 CTTGTTTTTAAATATTTTAATGG + Intronic
1071774585 10:88771119-88771141 TTTGCTTTTAAAAATGTTTATGG + Intronic
1071866528 10:89740573-89740595 GCTCCTTTGAAATAGCTTAAGGG - Intronic
1072114460 10:92356537-92356559 TTTCCTTTTGAATAAGATAATGG - Intergenic
1073784135 10:106869806-106869828 GTTCTTATTAAACATGTTATTGG + Intronic
1074602357 10:114927896-114927918 CTTCTTTTTAAATATTTTACAGG - Intergenic
1075497761 10:122941723-122941745 TGTCCTTTTAAACATGCTAATGG - Intronic
1078633318 11:13026226-13026248 ATTATTTTTAAATATGATAATGG + Intergenic
1078740331 11:14060048-14060070 ATTACTTTTAAAAATGTAAAGGG - Intronic
1078862270 11:15260183-15260205 GTTTTTTTTAAAGATGTTGAAGG + Intergenic
1078958736 11:16237032-16237054 GTTGCTATTAAATATTTTCATGG - Intronic
1080098702 11:28434588-28434610 GTTCCTTTTAAAGAAGTTGGAGG - Intergenic
1080282013 11:30568278-30568300 TTCATTTTTAAATATGTTAATGG + Intronic
1080526949 11:33131874-33131896 GTTCCTTTTAAGTGTGATAATGG + Intronic
1081018854 11:37917488-37917510 TTTCCTTTTAAATATCTGATAGG + Intergenic
1082188642 11:49215173-49215195 GTTTACTTTAAATATTTTAAGGG - Intergenic
1082622999 11:55447093-55447115 CTTCATTTTAAATGTGTTTATGG - Intergenic
1082929392 11:58584160-58584182 GTTGCTTTTTAATTTGTAAAGGG + Intronic
1083079657 11:60077484-60077506 GTTCCTTATAAAAATGTTGTAGG + Intergenic
1084277211 11:68059434-68059456 TATCCTTTTACATATGTTAGTGG + Intronic
1086589712 11:88498661-88498683 TTTTCTGTTTAATATGTTAATGG + Intergenic
1086677882 11:89631512-89631534 GTTTACTTTAAATATTTTAAGGG + Intergenic
1087481438 11:98706218-98706240 GATCCTTATATATATGTTATGGG + Intergenic
1087988743 11:104720148-104720170 GTTACTTTTACATATTATAAAGG - Intergenic
1089478428 11:118785334-118785356 GTTCCCTTTTTATATGTAAAAGG + Intronic
1089724251 11:120460773-120460795 GTTTCTTTTTAATATTTTTATGG + Intronic
1089952118 11:122537581-122537603 GTTCCTTTTGGATCTGTTACTGG - Intergenic
1090589915 11:128254977-128254999 GTTATTTTAAAATATTTTAAAGG + Intergenic
1090624982 11:128599221-128599243 GCTGCTTTTAAATAGGTGAAGGG + Intergenic
1091974491 12:4813571-4813593 GTTCTCTTTAGATATGTTCAGGG + Intronic
1093189967 12:16062691-16062713 TTTACTTTTAAATTTATTAATGG - Intergenic
1093263317 12:16968470-16968492 TTTCCTTTTTAAAATGTGAATGG - Intergenic
1093270533 12:17055052-17055074 ATTCTTTTTAAAATTGTTAATGG - Intergenic
1093585511 12:20830710-20830732 GTTCCTTTTAACTTTGTCCAGGG + Intronic
1094806059 12:34093435-34093457 GTTATTTTTCAATATGTTTAAGG + Intergenic
1095526849 12:43136618-43136640 CTTCTTTTTAAATCTGTTCAAGG - Intergenic
1095795843 12:46218073-46218095 GTTCTTTGTAAAAAAGTTAAAGG + Intronic
1095824828 12:46520167-46520189 GCTGCTTTTTAATATGGTAACGG - Intergenic
1096200335 12:49677209-49677231 ATTACTTTTAAATGTGTTCATGG + Intronic
1097411641 12:59261533-59261555 GTTACTTTTAAATATTGGAAAGG + Intergenic
1097440422 12:59601455-59601477 GTTCTTCTCAAATATGTGAAAGG + Intronic
1097513916 12:60578962-60578984 TTTCCATTTAAAAATATTAAGGG - Intergenic
1097551318 12:61075415-61075437 GTTCCTTTAAAACATTTTAGTGG + Intergenic
1098906927 12:76171809-76171831 ATTTCTTTTTAATTTGTTAATGG - Intergenic
1099368681 12:81802225-81802247 TTTGCTTTTAAATTTGTTTATGG - Intergenic
1099506717 12:83486592-83486614 GTACCTTATAAATATTATAATGG + Intergenic
1099601231 12:84740721-84740743 CTTTCTTTTAAAAATGTAAATGG - Intergenic
1099867514 12:88302356-88302378 GTTTCTATTAAGTATTTTAAAGG - Intergenic
1100160282 12:91852008-91852030 GCTCTTTTTAAATTTGTTGAAGG - Intergenic
1100227754 12:92575831-92575853 GTTATTTTTAAATATTTCAAAGG + Intergenic
1102063580 12:109953933-109953955 TTACCTTGTAAATATGTTATAGG - Intronic
1102344098 12:112147587-112147609 TTTACTTTTAAATATTTTTATGG - Intronic
1103058619 12:117841198-117841220 CTTCCTTTAAAATATGCTGAGGG - Intronic
1103132802 12:118483414-118483436 GTTTCTTTTCAATCTGATAATGG - Intergenic
1105221898 13:18337720-18337742 TTTCCTTTTAAAAATAATAATGG + Intergenic
1105354684 13:19648640-19648662 TTTCCTTTTTAATATGATGAGGG + Intronic
1105355884 13:19659190-19659212 TTTCATTTTAGATGTGTTAAGGG + Exonic
1105467194 13:20655941-20655963 GTTCACTTTAAATATTTTAGTGG - Intronic
1106322153 13:28651062-28651084 GTTTCTTTTTAATTTGATAAAGG + Intergenic
1106493414 13:30250700-30250722 ATTCATTTTAAAGTTGTTAAAGG - Intronic
1106516516 13:30459745-30459767 GTACCTTTTAAATAAGTATAAGG - Exonic
1107535230 13:41322961-41322983 GTTCATTAGAAATGTGTTAAAGG + Intronic
1107686090 13:42900174-42900196 GTTACCTTTAAATCTGTTATTGG - Intronic
1107958129 13:45537237-45537259 GGCCCTTTTACACATGTTAAAGG + Intronic
1108316832 13:49244650-49244672 GTTCATCTTACATATGTTGATGG + Intergenic
1108572565 13:51765791-51765813 ATTCTTTTTAAAGATGGTAAGGG + Exonic
1109010909 13:56942891-56942913 GTACTTTTTAGATATTTTAAGGG - Intergenic
1109145940 13:58779846-58779868 TTTCCTTTTTATTATGTTAATGG - Intergenic
1109232892 13:59780814-59780836 TTTCCTTTTGGACATGTTAATGG + Intronic
1110263666 13:73514322-73514344 GTGCCCCATAAATATGTTAATGG + Intergenic
1110500213 13:76218920-76218942 GTTGCTTTAAAATATGGTAATGG - Intergenic
1110586291 13:77197493-77197515 TTTTCATGTAAATATGTTAAAGG - Intronic
1110601399 13:77378349-77378371 TTCCCTTCTACATATGTTAAGGG - Intergenic
1110800315 13:79686387-79686409 AAAACTTTTAAATATGTTAAAGG + Intergenic
1111155676 13:84320765-84320787 GATGCTATTAAATATGTCAAAGG - Intergenic
1112274880 13:98007268-98007290 GTTCCCTTTAAATATGTGCTTGG + Intronic
1113173399 13:107532954-107532976 TATCATTTTTAATATGTTAATGG - Intronic
1114334975 14:21679376-21679398 AAGCCTATTAAATATGTTAAAGG - Intergenic
1114580561 14:23755406-23755428 CATCTTTTTAAATATGGTAATGG - Intergenic
1114888517 14:26886214-26886236 GTTTCTGTTAAATATGTCACTGG + Intergenic
1115142025 14:30182723-30182745 TTGCCTTTTAAATATGCAAAAGG + Intronic
1115287334 14:31729993-31730015 GATCCTTTTTATTAAGTTAAGGG + Intronic
1115709976 14:36039878-36039900 TTTCCTTTTTTATATGTGAATGG + Intergenic
1115805644 14:37048168-37048190 CTTCCTTTCAGATATGTTGAGGG - Intronic
1115838600 14:37439814-37439836 ATTGTTTTTAAGTATGTTAATGG - Intronic
1116251745 14:42493295-42493317 TTTTCTTTAAAATATGTTGAAGG - Intergenic
1116382730 14:44291567-44291589 GTTGCTTATAAAAATGTTACAGG - Intergenic
1117030785 14:51667860-51667882 ATTCATTTTAAATCTGTGAAAGG + Intronic
1117296870 14:54388438-54388460 TTTAATCTTAAATATGTTAATGG - Intergenic
1117806844 14:59502219-59502241 ATTGCTTTTAAATACGTTAATGG + Intronic
1118425845 14:65660704-65660726 ATTCTTGTTTAATATGTTAAGGG + Intronic
1119043710 14:71298472-71298494 CCTCCTTTTAAATATGCCAAGGG - Intergenic
1119305276 14:73602924-73602946 AAGCCTGTTAAATATGTTAAAGG + Intergenic
1120043383 14:79778804-79778826 GTTACTTTTAGATTTGTTCAGGG + Intronic
1120474052 14:84964458-84964480 CTTCCTTTTACATATCTTACTGG + Intergenic
1120641806 14:87022407-87022429 GTTTCATTTACATATTTTAAAGG + Intergenic
1121435131 14:93914177-93914199 GTTTCTTTTAAAAATGTTTCTGG - Intergenic
1121850359 14:97216722-97216744 TTTGCTTTTAACTATGTGAATGG + Intergenic
1122474108 14:101994099-101994121 GTTCATTTTAATTAAGTAAAAGG + Intronic
1123673703 15:22687251-22687273 GCTCCTTTTAAATAGGATAGTGG + Intergenic
1124325705 15:28760242-28760264 GCTCCTTTTAAATAGGATAATGG + Intergenic
1125009778 15:34858282-34858304 GTACTTTTTAAAAATCTTAAAGG - Intronic
1125188390 15:36959804-36959826 ATTCATTTTAAATAGGCTAAGGG + Intronic
1125390097 15:39183389-39183411 CATCATTTTAAATAGGTTAATGG + Intergenic
1125853725 15:42928869-42928891 GTACATTTTATATATGATAAAGG + Intergenic
1126090984 15:45051476-45051498 GAGCCTGTTAAATATGTTAGCGG + Intronic
1126392730 15:48177630-48177652 ATTCCTTTTAAATATGTTCTCGG + Intronic
1127202216 15:56667381-56667403 GTTTCTTTTATAGTTGTTAAAGG - Intronic
1127665716 15:61144947-61144969 GTTATTTTTAAAAATATTAATGG + Intronic
1127828503 15:62727689-62727711 GTTCCTTATAGAGATGTTTAAGG - Intronic
1129024798 15:72560764-72560786 GTTCATTTAAAAGATTTTAATGG + Intronic
1129497509 15:75999392-75999414 GTTCCTTATAAAAAGGCTAAAGG + Intronic
1130004027 15:80077435-80077457 TTTGCTTTAAAATATGTTAGAGG - Intronic
1131818832 15:96250745-96250767 GTGCCTTTGAAAAATATTAAGGG + Intergenic
1132002565 15:98194671-98194693 CTTTCTTTGAAAAATGTTAATGG - Intergenic
1132127291 15:99239177-99239199 GTACCTCCTAAAAATGTTAAAGG + Intronic
1132308700 15:100839139-100839161 GTTTTTTTTAACTATGTTCATGG - Intergenic
1132334792 15:101039858-101039880 TTTTCTGTTAAATATGTTGATGG + Intronic
1133091678 16:3409246-3409268 TATCCTCTAAAATATGTTAAGGG + Exonic
1136949200 16:34694551-34694573 TTTCCTTTGATATAAGTTAAGGG - Intergenic
1137819906 16:51434423-51434445 GATTCTTTTAAAAATTTTAAAGG + Intergenic
1137911984 16:52386829-52386851 GTTCATTTTAAATGGTTTAAAGG + Intergenic
1137916618 16:52438338-52438360 GTGCCTTTTAAATATTCTACTGG + Exonic
1138840407 16:60495654-60495676 GTTCAATTTATATATGTCAAGGG - Intergenic
1138895669 16:61200954-61200976 TTTCATTTTAAAGATTTTAAAGG - Intergenic
1138919379 16:61508600-61508622 GTTCTTTTACAATCTGTTAATGG + Intergenic
1139248094 16:65467814-65467836 GTTCTTTTTAAATATGACACTGG - Intergenic
1140355045 16:74297917-74297939 TTCCCATTTAAAAATGTTAATGG - Intronic
1140589932 16:76339804-76339826 GTTCCATTCAAATATGTCCATGG + Intronic
1144234717 17:13247548-13247570 AATCCTCTTAAATTTGTTAATGG - Intergenic
1144930423 17:18854591-18854613 CTTCCTTTAAAAAATGTTGAAGG + Intronic
1146247662 17:31304019-31304041 GTACATTTTACATATGTAAATGG - Exonic
1146714783 17:35076299-35076321 TTTACTCTTAAATATATTAAAGG + Intronic
1148281722 17:46353425-46353447 GTTGTTTTTAAAGATGTAAAAGG - Intronic
1148303947 17:46571364-46571386 GTTGTTTTTAAAGATGTAAAAGG - Intronic
1148939621 17:51196910-51196932 TTTCCTTTGAAATAGGTTCAAGG + Intronic
1149017787 17:51928913-51928935 GTTCCTTTTGCATTTGTGAAAGG - Intronic
1149055659 17:52361099-52361121 CTTCCTTTTAAATAGGTCATAGG + Intergenic
1149236897 17:54602032-54602054 TTTTATTTTAAATTTGTTAAGGG + Intergenic
1149470959 17:56914499-56914521 GTTCCTTTTTATTTTTTTAAAGG - Intergenic
1150330710 17:64292236-64292258 TTTCATTTTGAATATTTTAAAGG - Intergenic
1153149781 18:2078734-2078756 GTTTCATTTAGATATGTGAAAGG + Intergenic
1155397434 18:25401577-25401599 GTTCTTATTCAACATGTTAAGGG - Intergenic
1155587451 18:27383520-27383542 GTTACTCTTGAAAATGTTAATGG - Intergenic
1155838366 18:30615325-30615347 GTTCCTTTTCAAAATGTTTTTGG - Intergenic
1156014246 18:32529843-32529865 GCTCAATTTAAATATTTTAATGG + Intergenic
1156417438 18:36911914-36911936 GTTACTGTTAAATATTTTACTGG + Intronic
1156600899 18:38604725-38604747 ATTACTTTTAAATAATTTAAAGG - Intergenic
1156739582 18:40307750-40307772 TTTCATTTAAAATATGTGAAAGG + Intergenic
1157506366 18:48229562-48229584 ATTTCTTTTAAAGTTGTTAAAGG + Intronic
1158952413 18:62506542-62506564 GTTCATTTTAATCAGGTTAAAGG - Intergenic
1159051586 18:63425543-63425565 TTACATTTTAAATATGTAAACGG - Intergenic
1159183953 18:64945791-64945813 GTTGCTTTTAAAGGTTTTAACGG - Intergenic
1159810014 18:73006939-73006961 GTTCTTTTTGTATATTTTAATGG - Intergenic
1160009910 18:75098813-75098835 TTGCCTTTTTAATATCTTAATGG + Intergenic
1160486179 18:79294930-79294952 TTTCCTTTTAAAAATGTAGAAGG + Intronic
1167895651 19:52578690-52578712 GTTCTTTGTAAACATGTAAATGG + Intronic
1168138247 19:54366200-54366222 GTTCACTTGAAATTTGTTAACGG + Intronic
1168202006 19:54822294-54822316 TTTACTTTTAAAAATGGTAAAGG - Intronic
926536040 2:14114005-14114027 TTTGCTTTTTAATTTGTTAATGG - Intergenic
927294352 2:21436798-21436820 TTTCCTTTTAAATAGAGTAAAGG - Intergenic
927573509 2:24180942-24180964 GAACCTTTTAAGTATTTTAAAGG + Intronic
927768862 2:25840338-25840360 CTTCTTTTTAAATATTTTATTGG + Intronic
928703036 2:33918425-33918447 TTTCCTTTTAAATTAGTCAAAGG - Intergenic
928796428 2:35027298-35027320 ATTGATTTAAAATATGTTAAAGG + Intergenic
928917825 2:36492064-36492086 TTTCCTATTAAATATGTTTTTGG + Intronic
929320987 2:40543182-40543204 ATTCCTTTTAAACATCTTGAAGG - Intronic
929727132 2:44441789-44441811 GTTCCTTATAAATATTAAAAAGG - Intronic
930104212 2:47627531-47627553 GTTCCATTTAAATGTCTTATAGG - Intergenic
930251497 2:49039700-49039722 TGTCTTTTTAAATATTTTAATGG + Intronic
931302633 2:60995808-60995830 GTTTCTTTTAAAAATGTGTATGG - Intronic
931537107 2:63291305-63291327 CTTCCTTTTAAATGTGTTCTGGG - Intronic
933260943 2:80130779-80130801 GTTGCTTTTTAAAATGTTAATGG + Intronic
933605401 2:84377220-84377242 ATTCCATTTCAATATGTTCAAGG + Intergenic
934182134 2:89634673-89634695 TTTCCTTTTAAAAATAATAATGG - Intergenic
934292433 2:91708881-91708903 TTTCCTTTTAAAAATAATAATGG - Intergenic
934791238 2:97062584-97062606 GTTTCTTATATATATGTAAATGG - Intergenic
934954281 2:98604271-98604293 GTCCTTTTTAAAAGTGTTAAAGG + Intronic
935484841 2:103640451-103640473 TTTCCTTTTATATTTGGTAAAGG - Intergenic
937351244 2:121163923-121163945 GTTCCTTTTAAATATGGCTTAGG + Intergenic
938020736 2:127903856-127903878 GTCTCTTTAAAATATGTAAATGG - Intergenic
939087146 2:137734889-137734911 GTAATTTTAAAATATGTTAATGG - Intergenic
939303635 2:140380695-140380717 CTTACTTTTAAATAGGATAAAGG - Intronic
939648358 2:144730220-144730242 GTTGTTTTAAAATATTTTAATGG + Intergenic
942814890 2:180041284-180041306 GTTTCTTTCAAAAATGTTTATGG + Intergenic
943618608 2:190121624-190121646 GTTCCTTTAAAATATGCTTTTGG + Intronic
943673127 2:190686543-190686565 CTTCCTTTTAAAAATATTACAGG + Intronic
943865986 2:192924978-192925000 GTTCTATTTAAATATCTTAAAGG + Intergenic
944529311 2:200651719-200651741 GTACCTTTTAAAACTGTGAAAGG + Intronic
945042689 2:205755344-205755366 TTTCCCTTTCAATATCTTAAGGG - Intronic
945628810 2:212244962-212244984 CTCCCTTTTATAGATGTTAAGGG + Intronic
945631673 2:212286399-212286421 GTTGCTTTTATAAATGTTATGGG - Intronic
947003048 2:225479462-225479484 GTGCCTTTTAACTATTTCAATGG - Intronic
947478722 2:230477284-230477306 TTTTCTTTTAGATTTGTTAAGGG + Intronic
948328330 2:237144397-237144419 GGTGCTTTTAAATATGGGAATGG - Intergenic
1170260851 20:14406338-14406360 TTTCCTTTTACATATGGAAAAGG + Intronic
1170659128 20:18319058-18319080 GTTCCTGTTACAAACGTTAAGGG - Intergenic
1171317897 20:24211573-24211595 GTTCCTTAGAAATAGGATAATGG - Intergenic
1172140029 20:32716204-32716226 TTTCCTTTTAGATATGATAATGG + Intronic
1173116870 20:40252391-40252413 GATACTTTTAACTATGATAAAGG + Intergenic
1173637809 20:44576338-44576360 TGTACTTATAAATATGTTAAGGG + Intronic
1175627775 20:60503221-60503243 GGTCATTTTAAACATGTTTAGGG + Intergenic
1176730336 21:10488560-10488582 TTTCCTTTTAAAAATAATAATGG + Intergenic
1177319723 21:19505632-19505654 TTTCCTTTTAAATTTATTCATGG + Intergenic
1177533849 21:22398572-22398594 GTTCATTTTACCTATGTTGATGG + Intergenic
1177566356 21:22827417-22827439 GTTTCTTTAAAATTTGTTAGAGG - Intergenic
1177597915 21:23269617-23269639 AATTCTTTTAAATCTGTTAAGGG - Intergenic
1177987359 21:27993572-27993594 GTTTCTTTTAAATAAGCAAAAGG + Intergenic
1178445511 21:32637978-32638000 ATTACTTATAAATGTGTTAAAGG + Intronic
1178893400 21:36539142-36539164 ATTCATTTTAAAAATGTTTATGG + Intronic
1179331179 21:40403195-40403217 TTTCCTTTTTAATATTTCAAGGG - Intronic
1181100958 22:20538548-20538570 GTTTCTTTAAAAAATGTTGAAGG - Intronic
1183114202 22:35677077-35677099 GTTCTTTTTCAATATTGTAATGG + Intergenic
950477264 3:13222007-13222029 TTTCCTTTTCATTATGGTAAAGG + Intergenic
951075687 3:18389151-18389173 GTTCGTCTGAAATATGTTGATGG + Intronic
951281500 3:20755667-20755689 GTTCATTTCAAAAAGGTTAAAGG - Intergenic
951420170 3:22474581-22474603 TTGACTTTTAAATATGTTAAAGG - Intergenic
951494076 3:23306126-23306148 GTTTCTTTTAAATATTTCAGTGG - Intronic
952610956 3:35208192-35208214 AATTCTTTTAAATATGTTGAGGG - Intergenic
953431827 3:42846341-42846363 TTTTCTTTTAAATATTTTCAAGG - Intronic
953504600 3:43472385-43472407 TTTCATTTTAAAAATTTTAAGGG - Intronic
954095989 3:48328635-48328657 GCTACTTTTAAATATTTTATTGG - Intergenic
957418508 3:79937284-79937306 GTACCTTTTATAAATGTTTAAGG - Intergenic
957483860 3:80832580-80832602 GTTGCTATTAAGTATGTTATGGG - Intergenic
957564499 3:81866609-81866631 GTACATTTTACATATATTAATGG - Intergenic
957737587 3:84223069-84223091 GCTCTTTATAAATGTGTTAATGG - Intergenic
957833828 3:85559370-85559392 TTTCCTATTCAATATCTTAATGG + Intronic
958168397 3:89906880-89906902 GTGGCTTTCAAATAGGTTAAGGG + Intergenic
960427968 3:117532147-117532169 TTTGCTTTTAAATACCTTAATGG + Intergenic
960445083 3:117738260-117738282 GTTTATTTTAAATATGTTCAGGG - Intergenic
960497336 3:118391024-118391046 TTTCTTTTTGAAAATGTTAAAGG - Intergenic
963029987 3:140960609-140960631 CTTCCTTTTTATTATGGTAAAGG - Intronic
963082090 3:141403234-141403256 GTGCCTTATACATATTTTAAAGG + Intronic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964365238 3:155943272-155943294 GTGTCTTTTAACTTTGTTAAGGG + Exonic
965512816 3:169587655-169587677 GTTCCTCCTAAATATTTTATAGG - Intronic
965848938 3:172998566-172998588 GTTGCTTTTCAATATGTCACTGG - Intronic
966133149 3:176667158-176667180 TTTCCTTTTAACTAATTTAAAGG - Intergenic
966536331 3:181038579-181038601 AAGCCTATTAAATATGTTAAAGG + Intergenic
967553735 3:190830952-190830974 GCTCCTTATGAATATTTTAAGGG - Intergenic
967618747 3:191605594-191605616 TTTCCTTTGCAATATTTTAATGG - Intergenic
967665846 3:192170989-192171011 GTTCCTTATTTACATGTTAAGGG - Intronic
967926903 3:194657361-194657383 GTTCCTTTTAAATATGTTAATGG - Intronic
969969923 4:11035909-11035931 GTTCCTTCTAAACATTTGAATGG + Intergenic
970249667 4:14101040-14101062 GCTCCTTTGAAATAGGGTAAAGG - Intergenic
970951809 4:21765332-21765354 GGTCTTATTAACTATGTTAATGG + Intronic
970992758 4:22231961-22231983 GTTCCTTTAATATTCGTTAATGG - Intergenic
971065151 4:23023175-23023197 GATCCATTTAAAATTGTTAAAGG - Intergenic
971707152 4:30059527-30059549 TTTCCTTCAAAATATGTTCAAGG - Intergenic
971731512 4:30388100-30388122 ATTTCTTTAAAAGATGTTAATGG + Intergenic
971865643 4:32167930-32167952 GTTGCTTTTAAACATGAGAAGGG - Intergenic
974135245 4:57808310-57808332 ATTACATTTAAATATATTAATGG + Intergenic
974496392 4:62634001-62634023 ATTCCTTTTAAACATAGTAATGG + Intergenic
974899899 4:67984108-67984130 GGCCATTTAAAATATGTTAAAGG + Intergenic
975660786 4:76687130-76687152 TTTTATTTTAAATATTTTAATGG - Intronic
975664431 4:76720960-76720982 TTTCCTTTTTAAAATGTGAAAGG + Intronic
975923440 4:79420623-79420645 GTTGGTTTTATATATGTAAATGG - Intergenic
976545278 4:86328138-86328160 CTTTCTTGTAAATTTGTTAAAGG - Intronic
976600384 4:86932735-86932757 CTCCCTTTTAAATATGATGATGG - Intronic
976627425 4:87201638-87201660 ATTTCTTTTAAATTTGTTTAGGG - Intronic
978165946 4:105607021-105607043 GTTACTTTTAGAGATGTTAGTGG + Intronic
979093225 4:116514703-116514725 GTTCATTATAAATGTGTTATTGG - Intergenic
979844887 4:125495758-125495780 TTTCATTTTAAATATTTTAAGGG - Intergenic
980438469 4:132811856-132811878 TTTTCTTTTAAACACGTTAATGG + Intergenic
981269260 4:142825098-142825120 GCTCCTTTGACATATTTTAAAGG + Intronic
982920318 4:161266520-161266542 GTTTATTTTACATATGTTGATGG - Intergenic
982928572 4:161371457-161371479 TTTCTTTTTAAATGTGATAAAGG + Intergenic
983094095 4:163541715-163541737 TTTCTTTTAAAATATTTTAAAGG + Intronic
984010803 4:174369320-174369342 TTTCCTTTTAAAAATGTTTTAGG - Intergenic
984542444 4:181056571-181056593 ATACTTTTTAAATATATTAAAGG - Intergenic
984582641 4:181527916-181527938 GTTCTTTAAAAATATATTAATGG + Intergenic
985374745 4:189323089-189323111 GTTCCTGTCAAATATGTGCACGG - Intergenic
986106288 5:4662487-4662509 GTTCCTTTAAACTAGGTTATGGG - Intergenic
987064604 5:14276741-14276763 GTTCTTTCTAAATAAGTGAAAGG + Intronic
987170876 5:15256300-15256322 CTTCCTTTTAAAAATGATTAGGG - Intergenic
987452677 5:18105785-18105807 GTGTCTTTTGAATATGTTGATGG + Intergenic
988012645 5:25510375-25510397 TTTCAATTAAAATATGTTAATGG - Intergenic
988460079 5:31427283-31427305 TTTCATTTTGATTATGTTAATGG - Intronic
989264083 5:39452680-39452702 AATACTTTTAAATATCTTAAAGG + Intronic
989298151 5:39854372-39854394 GTGCCATTTTAATATGATAAGGG - Intergenic
989439862 5:41457657-41457679 GTTTATGTGAAATATGTTAAGGG - Intronic
989606642 5:43250154-43250176 ATTAGTTTTAAATATGCTAATGG + Intronic
989759641 5:44997808-44997830 TTACCTTTTAAATAATTTAAGGG - Intergenic
990269486 5:54120299-54120321 TTTCATTGTAAATATGTTTAAGG - Intronic
990637037 5:57740204-57740226 GATCCTTTAAAATATATTGATGG + Intergenic
991110259 5:62891731-62891753 TTTTCTTGTAAATATGTTTAAGG + Intergenic
991522211 5:67513758-67513780 GTTCATTTCAAAGATTTTAAAGG - Intergenic
991936748 5:71809749-71809771 GTTCTTTTTAAACAAGGTAATGG - Intergenic
992223949 5:74600358-74600380 GTTCCTTCTACATATATTTAGGG - Intergenic
992677530 5:79120771-79120793 TTTCATTTTAAAAATGCTAATGG + Intronic
993564821 5:89460649-89460671 GTTAATTTTATATATGGTAAAGG - Intergenic
994613096 5:102070809-102070831 AATTCTTTTAAATATGTTTAAGG - Intergenic
994679993 5:102874746-102874768 TTTCCTAGTAAATATTTTAAAGG + Intronic
994902958 5:105800281-105800303 GTTCCTTTTAATTCTGTTGTTGG - Intergenic
995225738 5:109698771-109698793 TTTTCTTTTAAACATGTAAAAGG + Intronic
995291112 5:110455121-110455143 ATTACTTTGATATATGTTAAAGG + Intronic
996105746 5:119500494-119500516 GTTGGTTTTAAATATGTTTGAGG + Intronic
996424348 5:123296870-123296892 GTTTATTTTTAATATGTTTATGG + Intergenic
996598518 5:125233105-125233127 CTTCCTTTTAAATGTGTTCAGGG - Intergenic
996676417 5:126180085-126180107 CTTTATATTAAATATGTTAAGGG + Intergenic
996845307 5:127892490-127892512 GTTCATTTTAGATTTTTTAAAGG - Intergenic
997288734 5:132707299-132707321 TTCCCTTTTAAATATCTCAATGG - Intronic
998557066 5:143135854-143135876 GTTCCTTTTAAATATCTGGCTGG + Intronic
998853690 5:146374850-146374872 GTTCATTTTAAAAATATTTATGG - Intergenic
998919316 5:147050406-147050428 GTTGGTTCTAAATATGTGAAAGG + Intronic
999961063 5:156756081-156756103 GTTCCTTTTTAACATGTTTAAGG + Intronic
1000861317 5:166459377-166459399 GTTCCTTAAAAATAGATTAATGG + Intergenic
1005173082 6:23010887-23010909 TTTCCTTTTTAATATATTAAAGG + Intergenic
1006065668 6:31460750-31460772 ATGGTTTTTAAATATGTTAACGG - Intergenic
1007097668 6:39223864-39223886 GTTGCTTTTAAATATTTTCCTGG - Intronic
1007833750 6:44658292-44658314 GTTCACTTTAAATTAGTTAATGG - Intergenic
1008862638 6:56168498-56168520 GTTTCTTTGAAATATGTAATAGG - Intronic
1009863236 6:69362980-69363002 GGCTCTTTTAAATGTGTTAAAGG + Intronic
1010590231 6:77703782-77703804 TTTCCTTTTCAATTTGATAATGG - Intronic
1012502905 6:99909410-99909432 TTTCCTTTTAATCTTGTTAATGG - Intergenic
1013026666 6:106280961-106280983 GCTCCTTTTAAATTTATTAAAGG - Intronic
1013093673 6:106924271-106924293 ATTGCTGTTAAATATTTTAAAGG - Intergenic
1013095604 6:106942039-106942061 CTTCCTTTTAAATCTAATAATGG + Intergenic
1013692203 6:112659118-112659140 GACTCTCTTAAATATGTTAATGG + Intergenic
1013844738 6:114435789-114435811 GTACCCTTTAGATATGCTAAGGG + Intergenic
1013892865 6:115045870-115045892 TTTCCTTTTAAATATCTTAAAGG + Intergenic
1014111800 6:117626136-117626158 AAGCCTATTAAATATGTTAAAGG - Intergenic
1014307915 6:119765570-119765592 TTTCCTATTAAATTTGTGAAGGG + Intergenic
1014511773 6:122331390-122331412 GTTCTTTTTTAATGTTTTAATGG - Intergenic
1014645686 6:123969644-123969666 TTTCCTGATAAATGTGTTAAAGG - Intronic
1014689462 6:124544935-124544957 GATCCTTCTAAATTTGTAAATGG + Intronic
1016339268 6:143044071-143044093 TATTCTTTTAAATTTGTTAAGGG - Intergenic
1017217667 6:151928936-151928958 TGTTCTTTTAAATTTGTTAAGGG + Intronic
1017573599 6:155776063-155776085 ATTCATATTAAATATGTTCACGG - Intergenic
1018156920 6:160993312-160993334 GTTTATTATAAATTTGTTAACGG + Intronic
1018539866 6:164867544-164867566 GTTACTTCTAAATATTTCAATGG - Intergenic
1018607813 6:165617105-165617127 TTTCCATTTAAGGATGTTAAAGG - Intronic
1018661642 6:166092699-166092721 GTTCCTTTAAAAAATATCAATGG - Intergenic
1018948757 6:168364934-168364956 GTTCCTTTTAAATATCACCACGG + Intergenic
1019140960 6:169942269-169942291 GTACTTTTTAAATTTCTTAAAGG - Intergenic
1021096904 7:16545951-16545973 GTTACTTTTGAATATTTTTAAGG + Intronic
1021422212 7:20458402-20458424 GTCCATTTAAAAAATGTTAATGG + Intergenic
1021728209 7:23570716-23570738 GTTCCTTTTGAATCTTTTGAAGG - Intergenic
1023037456 7:36145218-36145240 CTTCCTTTTAAACATGGTACTGG + Intergenic
1023469907 7:40505945-40505967 GTTACATTTATATATGTTAAAGG + Intronic
1023494571 7:40780801-40780823 GGTGTTTTTAAATTTGTTAAAGG - Intronic
1023622142 7:42084735-42084757 TTTACTTTGAAATATGCTAATGG + Intronic
1026585473 7:71652694-71652716 GTTGCTTTTAACAATGTAAATGG + Intronic
1026845367 7:73696121-73696143 TTTCCTCTTAAATGTCTTAAAGG - Intronic
1027823136 7:83074551-83074573 GTTCCTTTAAAAGATTTTAATGG - Intronic
1030389421 7:108907440-108907462 GTTCCTTTTAAATCTGGTATTGG + Intergenic
1030788690 7:113696031-113696053 GTACCCTTCAAATTTGTTAAGGG - Intergenic
1030849919 7:114471110-114471132 GTATTTTTTAAGTATGTTAAAGG + Intronic
1032632241 7:133666265-133666287 GTTCCTCTGACATATGTTACAGG + Intronic
1032685629 7:134231385-134231407 GGTCCTTTTGAATATGGGAATGG - Intronic
1033124655 7:138697068-138697090 GTTCATTTTAAAACTGTTACAGG + Intronic
1033370420 7:140702391-140702413 AATCCTATTAAATATGCTAATGG - Intronic
1033398151 7:140995038-140995060 GTTTTTTTTAAATATGTTTCAGG - Intergenic
1033931127 7:146523446-146523468 GTTTTATTTAAATATTTTAAAGG - Intronic
1034599231 7:152232969-152232991 TTTCCTTTTAAAAATAATAATGG - Intronic
1035177576 7:157062821-157062843 GTTCCTTTTAAAACTGGGAATGG + Intergenic
1035856153 8:2978524-2978546 GTGCCTTTTAAATATACTTACGG + Intronic
1036575160 8:10021078-10021100 GTTCATTTTAAATATGTGAATGG + Intergenic
1037385288 8:18333185-18333207 AATCCTTTTAAAGATGTTCAGGG + Intergenic
1037400835 8:18493833-18493855 TTTGCTTTTAAAGATGCTAATGG - Intergenic
1037532162 8:19788093-19788115 ATTCCTTATATAAATGTTAAGGG + Intergenic
1037995565 8:23349825-23349847 GTTCCTTCCAAATATGTTTGGGG - Intronic
1038323524 8:26551689-26551711 TATTCTTTTAAATGTGTTAAGGG - Intronic
1038831974 8:31071968-31071990 GTTGATTTTAGGTATGTTAAGGG + Intronic
1038893899 8:31758931-31758953 TTACCTTTTTAATATGTTAAAGG + Intronic
1040400211 8:47042978-47043000 GTACCTCATAAATATGTAAAAGG + Intergenic
1042890007 8:73598532-73598554 AAACCTTTTAAATATGATAAAGG + Intronic
1043663864 8:82783247-82783269 ATTCCTTTTATGTATTTTAAAGG - Intergenic
1044099019 8:88106811-88106833 GTTACTTTTAAAAATTATAATGG - Intronic
1044344887 8:91093768-91093790 TTTCTTTTTAAATATGGAAATGG - Intergenic
1044482912 8:92713731-92713753 GTACCTTCTAAATGTGCTAATGG + Intergenic
1044711335 8:95061152-95061174 GTTCTTTTTACATAAGTTAAAGG - Intronic
1046579192 8:116070498-116070520 AAGCCTATTAAATATGTTAAAGG - Intergenic
1046715698 8:117564127-117564149 CTTTCTTTAAAAAATGTTAAAGG + Intergenic
1048273579 8:133048526-133048548 CTTCCTATTTGATATGTTAAGGG + Intronic
1049044886 8:140141811-140141833 TTTACTGTTATATATGTTAAGGG + Intronic
1050477104 9:6051493-6051515 CTTCCTTTTTATTAAGTTAAGGG - Intergenic
1050775005 9:9248728-9248750 TTGCCTTTTAAAGATGATAAAGG - Intronic
1050937576 9:11417609-11417631 GTTCTTTTTAAAAAAGTTTATGG + Intergenic
1051353273 9:16218217-16218239 GTGCCTTTAAAATATGTGATAGG + Intronic
1052452133 9:28644662-28644684 GTTCTTTTTAAATAAGTAAAAGG + Intronic
1052721454 9:32175764-32175786 GTTACTTTTAAAAGTGTGAATGG - Intergenic
1053022448 9:34704383-34704405 CTTCCTTGTCAATATTTTAAGGG - Intergenic
1053357836 9:37461839-37461861 GTTCATTTTACAAATTTTAAAGG - Intronic
1055247591 9:74265488-74265510 GTTCATTTTAAGTATGAGAATGG + Intergenic
1055860006 9:80738025-80738047 ATTGCTTTTAAACATTTTAAAGG - Intergenic
1056027705 9:82516615-82516637 GTTTCTTTTCAATATTTTAATGG - Intergenic
1056308024 9:85310274-85310296 TTTTCTTTTAAATATTTAAATGG + Intergenic
1057174178 9:92983622-92983644 GCTCCTTATAAATGTGTTATTGG - Intronic
1057428867 9:94976594-94976616 CTTCCTCTTAAATATCTTATGGG + Intronic
1058277050 9:103056474-103056496 CTTCCTTTTAAAAACATTAATGG - Intergenic
1058293105 9:103268788-103268810 ATTCCTATTTAATATTTTAATGG + Intergenic
1058343760 9:103931937-103931959 GGTCTTTTTAAAAAGGTTAAAGG + Intergenic
1060156496 9:121323789-121323811 GTACCCTTTAAAAGTGTTAAGGG - Intronic
1060271306 9:122144057-122144079 GTTTCCTTTAAAAATTTTAATGG + Exonic
1060455673 9:123793470-123793492 ATTCCTTTGAGACATGTTAAGGG + Intronic
1203583947 Un_KI270746v1:45507-45529 CTTCCTTTTAAAAATAATAATGG - Intergenic
1185755085 X:2646752-2646774 TGTCTTTTTCAATATGTTAAAGG - Intergenic
1186049681 X:5577531-5577553 CTTCCTTTGAAAAATGTTTATGG - Intergenic
1186385002 X:9101142-9101164 GTACCTTTTAATCATGTTAATGG - Intronic
1186972024 X:14857122-14857144 GTTACTTTTAAAAATCTTATTGG - Intronic
1187361298 X:18630073-18630095 GAGCCTTTTAAATATGGTATTGG - Intronic
1188095634 X:26017921-26017943 CATCCTCTTATATATGTTAATGG - Intergenic
1188359991 X:29241363-29241385 CATCCTTTTAAACAAGTTAAAGG + Intronic
1188717759 X:33481414-33481436 GTTCATTTTGTATATGGTAAGGG - Intergenic
1189001783 X:36955793-36955815 CTGCCTTTTCAATTTGTTAATGG - Intergenic
1191791801 X:64979010-64979032 GTTTCAATTAAATATGTTAATGG + Intronic
1192333029 X:70194360-70194382 GTTTCTTTTAAAAATGTCATTGG - Intronic
1193279597 X:79630618-79630640 GTTGCTGTTAAGTATGTTATGGG + Intergenic
1193665543 X:84310957-84310979 ATTCCTTTTAAATATCTGGAAGG + Intergenic
1193746676 X:85290229-85290251 GTTCGTTTTATATAGGATAATGG + Intronic
1193866388 X:86736480-86736502 GCTAATTTTAAATATGTTAGGGG + Intronic
1194073126 X:89351980-89352002 GTTCCTTTCAAATATATCATTGG - Intergenic
1194493866 X:94585431-94585453 GTTTCTTTGACATATGTTTATGG + Intergenic
1194935879 X:99948249-99948271 CTTCCTTTTAATTAGGTAAAGGG - Intergenic
1195099050 X:101536473-101536495 TTTCTTTTTAAGTATATTAACGG - Intergenic
1195599503 X:106729111-106729133 TTTCCTTTTACTTCTGTTAAGGG + Intronic
1196422157 X:115533813-115533835 GTTCATTTTAAATATTTTATAGG - Intergenic
1196475604 X:116080830-116080852 TTTCCATTAATATATGTTAATGG - Intergenic
1196616510 X:117772206-117772228 TTTCCTATTAAAAATGTAAATGG + Intergenic
1198545160 X:137684645-137684667 GTTCCTTCTAATTCTGTTGATGG + Intergenic
1199924221 X:152445702-152445724 GCTCTTTCTAAATATCTTAATGG + Intronic
1200727360 Y:6687720-6687742 GTTCCTTTCAAATATATCATCGG - Intergenic
1200728512 Y:6703495-6703517 GTTCCTTTCAAATATATCATCGG - Intergenic
1201757939 Y:17508390-17508412 ATCTCTTTTAAAAATGTTAAAGG - Intergenic
1201843616 Y:18397592-18397614 ATCTCTTTTAAAAATGTTAAAGG + Intergenic