ID: 967928782

View in Genome Browser
Species Human (GRCh38)
Location 3:194674867-194674889
Sequence GGTAGATTTTCGTAACGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 20}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967928782_967928785 22 Left 967928782 3:194674867-194674889 CCAAGACGTTACGAAAATCTACC 0: 1
1: 0
2: 0
3: 3
4: 20
Right 967928785 3:194674912-194674934 GTCTTCTCATCTGGTTAATGAGG 0: 1
1: 0
2: 11
3: 130
4: 1150
967928782_967928784 13 Left 967928782 3:194674867-194674889 CCAAGACGTTACGAAAATCTACC 0: 1
1: 0
2: 0
3: 3
4: 20
Right 967928784 3:194674903-194674925 TGAGTCTCAGTCTTCTCATCTGG 0: 1
1: 2
2: 43
3: 250
4: 832

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967928782 Original CRISPR GGTAGATTTTCGTAACGTCT TGG (reversed) Intergenic
903110575 1:21129673-21129695 GGTAGATTTTGGAAATGTCCTGG - Intronic
910711024 1:90180916-90180938 GTTATATTTTGGTAAGGTCTTGG + Intergenic
911434238 1:97834733-97834755 GTTAGAATTTCCTAAGGTCTAGG + Intronic
918599565 1:186340242-186340264 GGGAGAGTTTCTTAACCTCTTGG - Intronic
1064003198 10:11680575-11680597 GGGAAATTTTCATAACTTCTAGG - Intergenic
1094768852 12:33629681-33629703 GGCAGATTTTGGTAACGTCAAGG + Intergenic
1104214294 12:126721019-126721041 GGTCAATTTTGGCAACGTCTTGG + Intergenic
1127190771 15:56528410-56528432 TGTAGACTTTCATAAGGTCTAGG - Intergenic
1147955354 17:44130628-44130650 GGTACATTTTTGTAACTTCTGGG - Intergenic
1157298857 18:46465374-46465396 GGTAGATATTGATAAGGTCTGGG - Intergenic
946887849 2:224242064-224242086 GGTACATTGTCGTAACTTCTGGG - Intergenic
1171442121 20:25173522-25173544 GGGAGATTTTCATACCTTCTAGG + Intergenic
1173426858 20:42950651-42950673 AGTAGATTTTTATAATGTCTAGG - Intronic
957405236 3:79767109-79767131 GGTGGATTTTGGTAAACTCTTGG - Intronic
967928782 3:194674867-194674889 GGTAGATTTTCGTAACGTCTTGG - Intergenic
997008401 5:129847984-129848006 GGTGGATTTTCCTATCATCTTGG - Intergenic
1010731078 6:79391960-79391982 GGGAGATTTTCTTAATGTTTTGG - Intergenic
1018078259 6:160235368-160235390 GGGACATTTTCATAACTTCTAGG - Intronic
1026127955 7:67596180-67596202 GGTAGATTTTAGAGACTTCTAGG + Intergenic
1033325675 7:140376077-140376099 GGGAGTTTTTGGTAACTTCTTGG - Intronic
1035217029 7:157375420-157375442 GATAGATTTTTGTAACTTTTGGG + Intronic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1058284807 9:103163923-103163945 GCTAAATTTTCGTAAACTCTTGG + Intergenic
1197160234 X:123314532-123314554 AGTAGATTTACTTAACATCTGGG - Intronic