ID: 967933686

View in Genome Browser
Species Human (GRCh38)
Location 3:194709355-194709377
Sequence ACCTCACATCTGGGGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 461}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967933686_967933691 -2 Left 967933686 3:194709355-194709377 CCAGGCCACCCCAGATGTGAGGT 0: 1
1: 0
2: 1
3: 36
4: 461
Right 967933691 3:194709376-194709398 GTGCTGTTAACACTGCTCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 129
967933686_967933693 19 Left 967933686 3:194709355-194709377 CCAGGCCACCCCAGATGTGAGGT 0: 1
1: 0
2: 1
3: 36
4: 461
Right 967933693 3:194709397-194709419 GGTGCATTGCTCAGCCCAGTGGG No data
967933686_967933692 18 Left 967933686 3:194709355-194709377 CCAGGCCACCCCAGATGTGAGGT 0: 1
1: 0
2: 1
3: 36
4: 461
Right 967933692 3:194709396-194709418 AGGTGCATTGCTCAGCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967933686 Original CRISPR ACCTCACATCTGGGGTGGCC TGG (reversed) Intergenic