ID: 967933686

View in Genome Browser
Species Human (GRCh38)
Location 3:194709355-194709377
Sequence ACCTCACATCTGGGGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 461}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967933686_967933691 -2 Left 967933686 3:194709355-194709377 CCAGGCCACCCCAGATGTGAGGT 0: 1
1: 0
2: 1
3: 36
4: 461
Right 967933691 3:194709376-194709398 GTGCTGTTAACACTGCTCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 129
967933686_967933693 19 Left 967933686 3:194709355-194709377 CCAGGCCACCCCAGATGTGAGGT 0: 1
1: 0
2: 1
3: 36
4: 461
Right 967933693 3:194709397-194709419 GGTGCATTGCTCAGCCCAGTGGG No data
967933686_967933692 18 Left 967933686 3:194709355-194709377 CCAGGCCACCCCAGATGTGAGGT 0: 1
1: 0
2: 1
3: 36
4: 461
Right 967933692 3:194709396-194709418 AGGTGCATTGCTCAGCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967933686 Original CRISPR ACCTCACATCTGGGGTGGCC TGG (reversed) Intergenic
900602917 1:3510743-3510765 ACTGCACAGCTGGGGTGGCCTGG - Intronic
900855422 1:5177960-5177982 ACCTCACATCTGCAGGGACCCGG + Intergenic
901734846 1:11305895-11305917 ACTTCTCAGATGGGGTGGCCGGG + Intergenic
905210458 1:36370377-36370399 ACCACAAACCTGGAGTGGCCTGG - Intronic
906356009 1:45106374-45106396 ACTTCCCAGATGGGGTGGCCGGG - Intronic
906998682 1:50827090-50827112 ACCTCCCAGATGGGGTGGCCGGG - Intronic
907912745 1:58841288-58841310 TCCTCACATCTGGTGTGCTCTGG - Intergenic
910057530 1:83050333-83050355 ACATGACATTTGGAGTGGCCAGG - Intergenic
911569867 1:99508689-99508711 ACCTCCCAGATGGGGCGGCCAGG - Intergenic
911569887 1:99508763-99508785 ACCTCCCAGACGGGGTGGCCAGG - Intergenic
911569898 1:99508800-99508822 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
913022827 1:114804644-114804666 ACTTCTCAGATGGGGTGGCCGGG + Intergenic
913078260 1:115359829-115359851 ACCTCCCAGATGGGGTGGCTGGG + Intergenic
913078388 1:115360265-115360287 ACCTCCCAGATGGGGTGGCTGGG + Intergenic
913944444 1:125145215-125145237 AGCTCACATCTGGTTTGTCCTGG + Intergenic
913954735 1:143278560-143278582 AGCTCACATCTGGTTTGTCCTGG - Intergenic
913982702 1:143536807-143536829 AGCTCACATCTGGTTTGTCCTGG + Intergenic
914404682 1:147358667-147358689 ACCTCACAACAGGGGTCACCAGG + Intergenic
915992536 1:160531895-160531917 ACTTCCCAGATGGGGTGGCCAGG - Intergenic
916037315 1:160933306-160933328 ACCTCTCAGATGGGGCGGCCGGG - Intergenic
916320410 1:163498702-163498724 ACCTCCCAGATGGGGTGGCTGGG + Intergenic
918702020 1:187617182-187617204 ACCTCCTAGATGGGGTGGCCAGG - Intergenic
919129692 1:193437451-193437473 ACTTCCCAGCAGGGGTGGCCGGG + Intergenic
921044110 1:211460921-211460943 ACCTCCCAGCAGGGGCGGCCGGG - Intergenic
921069891 1:211649966-211649988 GCCACAGATCTGGGGAGGCCTGG - Intergenic
922306473 1:224349775-224349797 ACCTCCCAGACGGGGTGGCCGGG + Intergenic
924439508 1:244074583-244074605 ACATCACATCTGTGGTGCCCAGG - Intergenic
1065335985 10:24656449-24656471 ACTTCACAGTAGGGGTGGCCGGG - Intronic
1066818653 10:39455672-39455694 ACCTCCCAGATGGGGTGGCCGGG + Intergenic
1066818724 10:39456012-39456034 ACCTCCCAGATGGGGTGGCTGGG + Intergenic
1067086672 10:43243736-43243758 ACCTCCCAGATGGGGCGGCCGGG - Intronic
1067100229 10:43329441-43329463 ACTTCACAGACGGGGTGGCCGGG - Intergenic
1067100321 10:43329782-43329804 ACCTTCCAGATGGGGTGGCCGGG - Intergenic
1067100368 10:43329929-43329951 ACCTCCCAGATGGGGCGGCCAGG - Intergenic
1067100380 10:43329966-43329988 ACCTCCCAGATGGGGTGGCCGGG - Intergenic
1067100417 10:43330079-43330101 ACTTCCCAGATGGGGTGGCCTGG - Intergenic
1067117400 10:43446313-43446335 ACCTCCCAGACGGGGTGGCCGGG + Intronic
1067333946 10:45346705-45346727 ACTTCCCAGATGGGGTGGCCAGG - Intergenic
1067334115 10:45347324-45347346 ACTTCCCAGATGGGGTGGCCGGG - Intergenic
1067334128 10:45347358-45347380 ACCTCCCAGATGGGATGGCCAGG - Intergenic
1067334345 10:45348159-45348181 ACTTCCCAGATGGGGTGGCCGGG - Intergenic
1067334358 10:45348193-45348215 ACCTCCCAGATGGGATGGCCAGG - Intergenic
1067334464 10:45348575-45348597 ACCTCCCAGATGGGGCGGCCAGG - Intergenic
1067433854 10:46263968-46263990 ACCTTACATCAGGGAGGGCCTGG - Intergenic
1067439832 10:46302340-46302362 ACCTGACATCAGGGAGGGCCTGG + Intronic
1067581983 10:47451922-47451944 ACCTGACATCAGGGAGGGCCTGG + Intergenic
1067691380 10:48504356-48504378 GCTTGACATATGGGGTGGCCTGG + Intronic
1067738355 10:48876846-48876868 ACCACACATCTGGGGCACCCTGG - Intronic
1068536302 10:58244198-58244220 ACCTCCCAGGTGGGGCGGCCGGG - Intronic
1069208622 10:65726963-65726985 ATCTCATATCTGGGCTGGTCTGG + Intergenic
1069674745 10:70239278-70239300 ACCTCCCAGACGGGGTGGCCGGG + Intergenic
1069674831 10:70239585-70239607 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1069867585 10:71513264-71513286 ACCTCAGATCAGGAGTAGCCAGG - Intronic
1070552562 10:77502156-77502178 ACCTAACAGCTGGGGGCGCCTGG + Intronic
1071326048 10:84519364-84519386 AGCTCACATGTGTGGTGGCCTGG - Intergenic
1071476800 10:86032262-86032284 ACCTCCCAGACGGGGTGGCCGGG - Intronic
1072480837 10:95809317-95809339 ACATCCCAGATGGGGTGGCCGGG + Intronic
1074352487 10:112751368-112751390 ACCTCACATCTGGCATGGCCAGG + Intronic
1074416497 10:113271944-113271966 ACCACAGATCAGTGGTGGCCAGG + Intergenic
1075243433 10:120798786-120798808 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1075892983 10:125970336-125970358 ACCTCCCAGATGGGGCGGCCGGG + Intronic
1075966389 10:126615328-126615350 ACCTCACATCTGGGATAACTTGG - Intronic
1076131063 10:128014222-128014244 CCCTCACAGCTGGGGTGTCCAGG + Intronic
1076133400 10:128028845-128028867 GCCAGACGTCTGGGGTGGCCAGG - Intronic
1076414543 10:130276385-130276407 ACCTCACTTCTGGGGGCCCCTGG + Intergenic
1076472897 10:130731725-130731747 ACATCAAATCTGGGGAGGCTAGG + Intergenic
1076516761 10:131049973-131049995 ACCTAACAAATGGGGGGGCCTGG + Intergenic
1076589732 10:131574788-131574810 CCCTCACTTCTGGAGTGGACAGG + Intergenic
1077040230 11:517593-517615 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1077311583 11:1891211-1891233 ACCTCCTGTCTGGGGTGGCCCGG + Intronic
1078905724 11:15686358-15686380 ACTTCCCAGATGGGGTGGCCGGG + Intergenic
1080983166 11:37431529-37431551 ACTTCCCAGATGGGGTGGCCAGG + Intergenic
1082166313 11:48955394-48955416 ACATCCCAGATGGGGTGGCCAGG + Intergenic
1082233608 11:49798100-49798122 ACTTCCCAGATGGGGTGGCCGGG + Intergenic
1082245000 11:49911652-49911674 ACTTCCCAGATGGGGTGGCCGGG + Intergenic
1083932953 11:65855846-65855868 CCCACACATCTGGGTTGACCAGG + Intronic
1084327013 11:68406359-68406381 ACCTCATGGCTGGGTTGGCCAGG - Intronic
1084645770 11:70456888-70456910 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1084929908 11:72546795-72546817 ACTTCACATCAGGAGTGGTCTGG - Intergenic
1084989592 11:72910063-72910085 ACCTCCCAGATGGGGCGGCCGGG - Intronic
1084989643 11:72910252-72910274 ACTTCCCAGATGGGGTGGCCGGG - Intronic
1085386719 11:76161896-76161918 CCCTACCATCTGGAGTGGCCTGG - Intergenic
1085716618 11:78879111-78879133 ACTTCCCAGATGGGGTGGCCAGG - Intronic
1087487030 11:98770148-98770170 ACTTCACAGACGGGGTGGCCGGG + Intergenic
1088257259 11:107912910-107912932 ACCTCCCAGTAGGGGTGGCCGGG - Intronic
1089044749 11:115490691-115490713 ACTTCACATCTGTTCTGGCCGGG - Intronic
1089572324 11:119418891-119418913 CCCTCACATCTGGGGTCTTCAGG + Exonic
1089581354 11:119483593-119483615 AGCTGTCATCTTGGGTGGCCCGG + Intergenic
1095068472 12:37814269-37814291 ACCTCCCAGTAGGGGTGGCCTGG + Intergenic
1095738714 12:45585622-45585644 ACTTCCCAGATGGGGTGGCCGGG + Intergenic
1096064041 12:48725001-48725023 ACCTCCCAGCAGGGGCGGCCGGG - Intergenic
1097138531 12:56879535-56879557 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1097626875 12:62011022-62011044 ACCTCCCAGATGGGGTGGCCGGG - Intronic
1098023107 12:66175019-66175041 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1098375347 12:69807893-69807915 ACCTCCCAGATGGGGCGGCCGGG + Intronic
1104810229 12:131616118-131616140 ACCTGACATCTGGGGAAGCCTGG - Intergenic
1105233899 13:18527493-18527515 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1105267544 13:18836296-18836318 ACCTCCCAGATGGGGTGGCGGGG + Intergenic
1105267564 13:18836370-18836392 ACTTCCCAAATGGGGTGGCCGGG + Intergenic
1105267706 13:18836864-18836886 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1105927443 13:25019930-25019952 ACCTCCCAGACGGGGTGGCCGGG + Intergenic
1107644044 13:42476287-42476309 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1107737523 13:43415780-43415802 ACCTCCCAGATGGGGCGGCCGGG + Intronic
1107737715 13:43416450-43416472 ACATCCCAGATGGGGTGGCCGGG + Intronic
1108608523 13:52063755-52063777 ACTTCTCAGATGGGGTGGCCGGG - Intronic
1111105621 13:83642211-83642233 ACATGACATTTGGGATGGCCAGG - Intergenic
1111237165 13:85424095-85424117 ACCTCCCATCTGGGGAGCCCTGG - Intergenic
1113566466 13:111322485-111322507 CCCTCACAGACGGGGTGGCCAGG - Intronic
1113639141 13:111944680-111944702 ACCTGCCATCTGGTGTGCCCTGG + Intergenic
1114587121 14:23825368-23825390 CTCTCACATCTGGAGTGCCCAGG - Intergenic
1115324859 14:32127802-32127824 ACCTCCCAGACGGGGTGGCCGGG + Intronic
1116502158 14:45635264-45635286 ACCTCCCAGATGGAGTGGCCGGG - Intergenic
1117051621 14:51866159-51866181 ACCCCACACCCGGGCTGGCCAGG - Intronic
1117597052 14:57334200-57334222 CCCTCACCTCTGGGGTGGGGCGG - Intergenic
1119735379 14:76978104-76978126 AGCTTAGGTCTGGGGTGGCCCGG + Intergenic
1121923474 14:97905451-97905473 ATCTAACATCTGGAATGGCCTGG + Intergenic
1122355803 14:101122260-101122282 GCCACACATCGGGGGAGGCCTGG - Intergenic
1122860912 14:104582021-104582043 ACCTCCCATGTGGGGTGGGTGGG + Intronic
1122953372 14:105058650-105058672 ACGTCACACCTCGGGTAGCCAGG - Intronic
1125031761 15:35081945-35081967 ACCTCCCAGATGGGGTGGCCGGG - Intergenic
1125031882 15:35082361-35082383 ACCTCCCAGATGGGGTGGCCGGG - Intergenic
1126685669 15:51246813-51246835 CCCTCACATCCAGGGTGGCTGGG - Intronic
1127088354 15:55445573-55445595 ACCTCCCAGATGGGGCGGCCAGG + Intronic
1127088376 15:55445647-55445669 ACCTCCCAGACGGGGTGGCCAGG + Intronic
1127088486 15:55446021-55446043 ACCTCCCAGACGGGGTGGCCGGG + Intronic
1127088528 15:55446172-55446194 ACCTCCCAGACGGGGTGGCCGGG + Intronic
1128489857 15:68134900-68134922 ACCTCCCAGCAGGGGTGGCTGGG + Intronic
1128490094 15:68135424-68135446 ACCTCCCAGCAGGGGTGGCTGGG + Intronic
1128498631 15:68211933-68211955 CCCTCACACCTGGGGTGGGATGG + Intronic
1128500074 15:68221719-68221741 ACCTCCCAGATGGGGTGGCCGGG - Intronic
1128500199 15:68222169-68222191 ACCTCCCAGATGGGGCGGCCGGG - Intronic
1129445959 15:75618162-75618184 AGCTCTCATCTGGGGTGGGATGG - Intronic
1129878779 15:78993845-78993867 CGCTCACTTCTGGGGTGGCCTGG + Intronic
1129879418 15:78996971-78996993 CCCTCACACCTGGGCTGGGCTGG + Intronic
1131106698 15:89739629-89739651 ACCACACATTTCGGGTGGACTGG + Intronic
1131800758 15:96067393-96067415 ACCTCACATCTGCTGTGGTTTGG + Intergenic
1133170948 16:3982231-3982253 TTCTCCCATCTGGGGTGGGCAGG - Intronic
1133595113 16:7283526-7283548 ACCTCCCCTCTGTGTTGGCCAGG + Intronic
1133680414 16:8115215-8115237 ACCTCTCAGATGGGGCGGCCGGG - Intergenic
1133689402 16:8198854-8198876 ACCTCACATCGGAGGTGGAACGG + Intergenic
1133833879 16:9350302-9350324 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1133833891 16:9350339-9350361 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1133833904 16:9350376-9350398 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1133833937 16:9350486-9350508 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1133833986 16:9350633-9350655 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1133833999 16:9350670-9350692 ACCTCCCAGACGGGGTGGCCAGG + Intergenic
1134234200 16:12452702-12452724 ACCTCACATTTGGAGGGGTCTGG - Intronic
1136155226 16:28377579-28377601 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1136207857 16:28737710-28737732 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1136228193 16:28872738-28872760 ACCTCACTTCTTGGGTGCACGGG - Intronic
1136640875 16:31564066-31564088 ACCTCAGCTCTGGTGTGTCCAGG - Intergenic
1136664091 16:31793248-31793270 ACCTCAGCTCTGGTGTGTCCAGG + Intronic
1136668684 16:31836833-31836855 ACCTCCCAGCAGGGGCGGCCGGG - Intergenic
1136919071 16:34246179-34246201 ACCTCTCTAATGGGGTGGCCAGG + Intergenic
1136946280 16:34655127-34655149 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1136949127 16:34693687-34693709 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1136968553 16:34944448-34944470 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1137089017 16:36164972-36164994 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1137093547 16:36224220-36224242 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1137218489 16:46424356-46424378 AGCTCACATCTGGTTTGTCCTGG - Intergenic
1137822126 16:51456230-51456252 ACCTCTCCTCTGGGGTCACCTGG - Intergenic
1138488450 16:57361738-57361760 ATCTCACACCTGGGGAGGCTGGG + Intronic
1139618125 16:68113528-68113550 ACCTCCCAACTGGGGTCACCAGG - Intronic
1141271664 16:82546498-82546520 ATCTCACACCTGGGGTTGGCTGG - Intergenic
1141932868 16:87217340-87217362 CACTCACACCTTGGGTGGCCTGG - Intronic
1143989290 17:10943036-10943058 ACCTGACCACTGGGGTGCCCTGG - Intergenic
1144288537 17:13803605-13803627 GCATCTCATCTGGAGTGGCCAGG - Intergenic
1145053875 17:19685333-19685355 ACTTCCCAGATGGGGTGGCCAGG - Intronic
1145927599 17:28659456-28659478 ACTTCCCAGATGGGGTGGCCGGG + Intronic
1146110402 17:30084227-30084249 AGCTCTCTTGTGGGGTGGCCAGG + Intronic
1146361356 17:32179400-32179422 ACTTCCCAGATGGGGTGGCCGGG - Intronic
1146361498 17:32179890-32179912 ACTTCCCAGATGGGGTGGCCGGG - Intronic
1148130479 17:45259633-45259655 ACCTCACCTCTGGAGTAGCTGGG + Intronic
1148485760 17:47989972-47989994 TCCTACCAGCTGGGGTGGCCTGG - Intergenic
1148672166 17:49419493-49419515 ACTTCCCAGATGGGGTGGCCGGG + Intronic
1148672186 17:49419569-49419591 ACATCCCAGATGGGGTGGCCAGG + Intronic
1149633168 17:58142942-58142964 ACTTCCCAGCAGGGGTGGCCGGG - Intergenic
1149642036 17:58209198-58209220 ACCTCCCAGATGGGGCGGCCGGG + Intronic
1149660410 17:58331712-58331734 ACCTCACGGTTGGGGTGGACTGG - Intergenic
1150596898 17:66614215-66614237 ACCTCAAAAATGGAGTGGCCAGG - Intronic
1150708870 17:67512691-67512713 TCCTCACATCTTTGGTGTCCAGG + Intronic
1151562817 17:74879684-74879706 ACCTCCCATGTGGGGGGACCTGG + Intronic
1151569173 17:74917571-74917593 ACTTCCCCTCTGGGGTGGACGGG + Exonic
1203184111 17_KI270729v1_random:95770-95792 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1154003382 18:10506004-10506026 ACTTCCCAGATGGGGTGGCCGGG + Intergenic
1154115863 18:11613175-11613197 ACCTCCCAGATGGGTTGGCCGGG - Intergenic
1154116123 18:11614155-11614177 ACATCCCAGATGGGGTGGCCGGG - Intergenic
1154116198 18:11614420-11614442 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1154116210 18:11614457-11614479 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1154120300 18:11647361-11647383 ACCTCCCAGATGGGGTGGCCGGG - Intergenic
1154120514 18:11648105-11648127 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1154120526 18:11648142-11648164 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1154120538 18:11648179-11648201 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1154420234 18:14222892-14222914 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1154420471 18:14223766-14223788 ACTTCCCAGATGGGGTGGCCGGG - Intergenic
1154420546 18:14224030-14224052 ACTTCCCAGATGGGGTGGCCAGG - Intergenic
1154420582 18:14224141-14224163 ACTTCCCAGATGGGGTGGCCGGG - Intergenic
1154420650 18:14224367-14224389 ACTTCCCAGATGGGGTGGCCAGG - Intergenic
1154420779 18:14224817-14224839 ACTTCCCAGATGGGGTGGCCGGG - Intergenic
1154483128 18:14856031-14856053 GCCTCCCACATGGGGTGGCCGGG + Intergenic
1154483140 18:14856068-14856090 ACCTCCTAGATGGGGTGGCCGGG + Intergenic
1154483488 18:14857430-14857452 GCCTCCCACATGGGGTGGCCGGG + Intergenic
1154483561 18:14857691-14857713 ACCTCCTAGATGGGGTGGCCGGG + Intergenic
1154483908 18:14859050-14859072 GCCTCCCACATGGGGTGGCCGGG + Intergenic
1154483920 18:14859087-14859109 ACCTCCTAGATGGGGTGGCCGGG + Intergenic
1154483982 18:14859311-14859333 ACCTCCTAGATGGGGTGGCCGGG + Intergenic
1154484276 18:14860486-14860508 ACCTCCCAGATGGGGTGGCTGGG + Intergenic
1154515643 18:15162382-15162404 AGCTCACATCTGGTTTGTCCTGG - Intergenic
1157260355 18:46171493-46171515 ACCTGCCAGCTGTGGTGGCCTGG - Intergenic
1157778475 18:50417483-50417505 ACTTCCCAGATGGGGTGGCCGGG + Intergenic
1160465466 18:79072826-79072848 ACCTCTCAGATGGGGCGGCCGGG + Intronic
1161080317 19:2307270-2307292 TCCTCAGAACTGGGGGGGCCGGG + Intronic
1161302944 19:3551682-3551704 ACCTGAGATCTGCGGTGGCAAGG + Intronic
1163909433 19:20176099-20176121 ACCTCTCAGATGGGGCGGCCAGG + Intronic
1164016419 19:21259568-21259590 ACCTCCCAGACGGGGTGGCCGGG + Intronic
1164168042 19:22700353-22700375 ACTTCCCAGCAGGGGTGGCCAGG + Intergenic
1164260994 19:23568436-23568458 ACTTCCCAGATGGGGTGGCCTGG - Intronic
1165291953 19:34892962-34892984 AACACACATCGGGGGTGGTCTGG - Intergenic
1165493129 19:36136810-36136832 ACCTAACACCTGGGGCTGCCGGG + Intergenic
1165852014 19:38855527-38855549 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1166103246 19:40583587-40583609 TCTGCACATCTGGGGTGGGCAGG - Exonic
1167913142 19:52720466-52720488 ACCTCCCAGATGGGGCGGCCGGG + Intronic
1167913154 19:52720503-52720525 ACCTCCCAGATGGGGCGGCCGGG + Intronic
1167913205 19:52720694-52720716 ACCTCCCAGATGGCGTGGCCGGG + Intronic
1168296406 19:55379136-55379158 GCCTCACCTCAGGTGTGGCCAGG + Intergenic
925650284 2:6082082-6082104 ACCACATATCTGGGGAGGCTTGG - Intergenic
927854409 2:26518922-26518944 GCCTCACACATGGGGTGGTCTGG - Intronic
929509658 2:42556718-42556740 CCCTCAGATCTGGGCTGGCATGG - Intronic
929587251 2:43124351-43124373 ACCACAGATGTGGGGTGGCTGGG - Intergenic
932285724 2:70530100-70530122 ATCTCCCATCTGAGGTGGTCAGG - Intronic
932336821 2:70936281-70936303 CCCTCTCTTCTGGGGTGGGCTGG - Intronic
933725859 2:85426846-85426868 GCCTGGTATCTGGGGTGGCCGGG + Intronic
933868484 2:86545608-86545630 ACTTCTCAGATGGGGTGGCCGGG + Intronic
933868530 2:86545795-86545817 ACCTCCCAGATGGGGTGGCCAGG + Intronic
933868874 2:86548721-86548743 ACTTCCCAGATGGGGTGGCCGGG + Intronic
933869172 2:86549702-86549724 ACCTCCCAGATGGGGCGGCCGGG + Intronic
934309633 2:91851795-91851817 ACTTCTCAGATGGGGTGGCCGGG - Intergenic
934332067 2:92077800-92077822 AGCTCACATCTGGTTTGTCCTGG + Intergenic
935567120 2:104620789-104620811 CTCTCACTTCTGGGGTGACCTGG + Intergenic
937905766 2:127052139-127052161 CCCTCACATCCATGGTGGCCTGG + Intronic
938828957 2:135033631-135033653 ACCTCCCAGCAGGGGTGGCTGGG + Intronic
938890925 2:135704708-135704730 TCCTAGCATCTGGGGAGGCCGGG - Intronic
940652174 2:156451222-156451244 ACCTCCCAGTAGGGGTGGCCGGG + Intronic
941603083 2:167563836-167563858 ACCTCCCAGCAGGGGCGGCCGGG + Intergenic
941683994 2:168428999-168429021 ACATCTCATCTGGGGTCACCTGG - Intergenic
943125669 2:183791983-183792005 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
943125703 2:183792094-183792116 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
943583546 2:189712147-189712169 ACCCCACATCTGGGGGGGCAGGG + Intronic
948309516 2:236974559-236974581 ATCTCCCATGTGGGGTGGCCGGG + Intergenic
948612375 2:239178129-239178151 TCCTCACACCTGTGGAGGCCTGG - Intronic
948843759 2:240673076-240673098 ACTGCAGCTCTGGGGTGGCCAGG - Intergenic
948850006 2:240701242-240701264 ACTGCAGCTCTGGGGTGGCCAGG + Intergenic
1169125799 20:3125755-3125777 ACCTCCCAGACGGGGTGGCCGGG - Intronic
1172338110 20:34133105-34133127 ACCTCCCAGCAGGGGCGGCCGGG - Intergenic
1172895403 20:38296370-38296392 TCACCCCATCTGGGGTGGCCAGG - Intronic
1173002876 20:39117867-39117889 ACTTTAAATCTGGGCTGGCCTGG - Intergenic
1176026723 20:62989778-62989800 ACGCCCCTTCTGGGGTGGCCCGG + Intergenic
1176777884 21:13155770-13155792 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1176797057 21:13378983-13379005 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1176797163 21:13379334-13379356 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1176797208 21:13379482-13379504 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1176797219 21:13379519-13379541 ACTTCCCAGATGGGGTGGCCGGG - Intergenic
1176797231 21:13379556-13379578 ACCTCCCAGATGGGGCGGCCAGG - Intergenic
1176797242 21:13379593-13379615 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1176797474 21:13380546-13380568 GCCTCCCAGATGGGGTGGCCGGG - Intergenic
1176797534 21:13380770-13380792 ACCTCCCAGGTGGGGCGGCCAGG - Intergenic
1176852595 21:13934761-13934783 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1176852650 21:13934950-13934972 ACATCCCAGATGGGGTGGCCGGG + Intergenic
1176852698 21:13935137-13935159 ACTTCCCAGATGGGGTGGCCGGG + Intergenic
1176852766 21:13935363-13935385 ACATCCCAGATGGGGTGGCCGGG + Intergenic
1176852810 21:13935513-13935535 ACCTCCCAGATGGGGTGGCCAGG + Intergenic
1176852878 21:13935780-13935802 TCCTCCCAGATGGGGTGGCCGGG + Intergenic
1176852926 21:13935928-13935950 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1176852987 21:13936155-13936177 ACCTCCCAGACGGGGTGGCCGGG + Intergenic
1177005996 21:15672727-15672749 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1177975498 21:27844777-27844799 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1180525662 22:16257197-16257219 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1181643762 22:24219451-24219473 ACCTCACCACTCTGGTGGCCAGG - Intergenic
1182484498 22:30631562-30631584 ACCTCCCAGTAGGGGTGGCCGGG + Intergenic
1182520679 22:30882920-30882942 AACTCACATCTGAGGGTGCCTGG - Intronic
1184169439 22:42750510-42750532 ACCTCCCAGCAGGGGCGGCCGGG + Intergenic
1184342626 22:43894280-43894302 GGCTCACTTCTGGGGTGGCTTGG + Intergenic
1184536734 22:45092684-45092706 ACCTCACATGGGGGGAAGCCAGG - Intergenic
1185011003 22:48314315-48314337 AACTCACGGCTGGGGTGTCCCGG + Intergenic
949566303 3:5247989-5248011 GCCACACATCTGGAGTGGCAGGG + Intergenic
950573020 3:13813697-13813719 ACCTTGAATCTGGGCTGGCCTGG + Intergenic
951264253 3:20548160-20548182 ACATCCCAGATGGGGTGGCCGGG + Intergenic
952776500 3:37051746-37051768 ACCTCACTTCTGAGATGCCCTGG - Intergenic
953322309 3:41983359-41983381 ACTTCTCAGATGGGGTGGCCAGG + Intergenic
953855093 3:46494636-46494658 ACTTCTCAGATGGGGTGGCCGGG - Intergenic
954460681 3:50625246-50625268 GGCTCTCATTTGGGGTGGCCTGG + Intronic
957265301 3:77956035-77956057 ACCTCACAGCTGGGGGACCCTGG + Intergenic
958406013 3:93760418-93760440 ACCTCCCAGATGGGGTGGCCGGG + Intergenic
958406159 3:93760949-93760971 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
958406185 3:93761025-93761047 ACTTCCCAGATGGGGTGGCCGGG + Intergenic
958406269 3:93761322-93761344 ACTTCCCAGGTGGGGTGGCCCGG + Intergenic
958406395 3:93761743-93761765 ACTTCCCAGATGGGGTGGCCGGG + Intergenic
958406450 3:93761930-93761952 ACCTCCCAGATGGGGTGGCCGGG + Intergenic
958406473 3:93762004-93762026 ACCTCCCAGATGGGGTGGCCGGG + Intergenic
958406485 3:93762041-93762063 ACCTCCCAGACGGGGTGGCCGGG + Intergenic
958406582 3:93762416-93762438 ACCTCCCAGATGGGGTGGCCAGG + Intergenic
958406811 3:93763197-93763219 ACATCCCAGATGGGGTGGCCAGG + Intergenic
958406899 3:93763500-93763522 ACCTCCCAGACGGGGTGGCCGGG + Intergenic
958406962 3:93763725-93763747 ACCTCCCAGAAGGGGTGGCCGGG + Intergenic
958407075 3:93764142-93764164 ACCTCCCAGACGGGGTGGCCGGG + Intergenic
958407205 3:93764586-93764608 ACCTCCCAGATGGGGTGGCTGGG + Intergenic
958560853 3:95745182-95745204 ACTTCTCAGATGGGGTGGCCGGG - Intergenic
959054228 3:101551941-101551963 ACCTCCCAGCCGGGGCGGCCGGG - Intergenic
959731893 3:109613582-109613604 ACCTCACAGCTGGGTTGGGAAGG + Intergenic
960057861 3:113288501-113288523 AGCTCACTTCTGGGGTGGGTAGG + Exonic
964485034 3:157178471-157178493 ACCTCACAGACGGGGTGGCTGGG + Intergenic
964485104 3:157178732-157178754 ACCTCACAGATGGGGCGGCTGGG + Intergenic
964485320 3:157179592-157179614 ACCTCCCAGATGGGGAGGCCGGG + Intergenic
967933686 3:194709355-194709377 ACCTCACATCTGGGGTGGCCTGG - Intergenic
968871392 4:3244481-3244503 ATCCCACCTCTGGTGTGGCCGGG + Intronic
969508285 4:7602226-7602248 ACCTCCCAGACGGGGTGGCCAGG + Intronic
969670329 4:8586639-8586661 AGCTCACATCTGGGGTGTGTTGG + Intronic
970009628 4:11444817-11444839 ACCTCACTTCAAGGGTGGACTGG - Intergenic
972525080 4:39901868-39901890 ACCACACATCCTGGTTGGCCTGG + Intronic
972700546 4:41490812-41490834 ACTTCCCAGATGGGGTGGCCTGG + Intronic
973021185 4:45207548-45207570 ACCTCCCAGATGGGGTGGCCGGG - Intergenic
973021206 4:45207622-45207644 ACCTCTCAGATGGGGTGGCCAGG - Intergenic
973330336 4:48906115-48906137 ACCTCTCAGCTTCGGTGGCCAGG + Intronic
974597838 4:64037249-64037271 ACCTCCCAGATGGGGCGGCCAGG - Intergenic
974848611 4:67380780-67380802 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
974848800 4:67381499-67381521 ACCTCCCAGATGGGGTGGCCAGG - Intergenic
976976234 4:91168509-91168531 ACCTCCCAGATGGGGCGGCCAGG - Intronic
976976253 4:91168585-91168607 ACTTCCCAGATGGGGTGGCCGGG - Intronic
977674946 4:99736981-99737003 ACTTGACATCTGTGCTGGCCAGG - Intergenic
978527092 4:109678350-109678372 ACCTCCCAGGTGGGGCGGCCGGG + Intronic
978527183 4:109678657-109678679 ACCTCTCAGATGGGGCGGCCAGG + Intronic
978947593 4:114516838-114516860 ACTTCCCAGCAGGGGTGGCCGGG - Intergenic
979482871 4:121238662-121238684 ACCTCCCAGGCGGGGTGGCCGGG - Intergenic
979823095 4:125198389-125198411 TCCTCACATCTGGAGTGCCTGGG + Intergenic
982053653 4:151526837-151526859 ACCTCTCAGATGGGGCGGCCGGG + Intronic
982319675 4:154064956-154064978 ACATGACATTTGGGGAGGCCAGG + Intergenic
983664393 4:170166192-170166214 ACTTCCCAGATGGGGTGGCCAGG + Intergenic
988532859 5:32040966-32040988 ACCTCCCAGACGGGGTGGCCAGG - Intronic
989655729 5:43745731-43745753 ACTTCCCAGATGGGGTGGCCAGG + Intergenic
989977952 5:50608173-50608195 ACATCCCAGATGGGGTGGCCGGG - Intergenic
990709252 5:58563785-58563807 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
991703135 5:69333957-69333979 AGCTCTCATCTGAGGGGGCCTGG - Intergenic
991935314 5:71794422-71794444 ACTTCCCAGATGGGGTGGCCGGG + Intergenic
991935375 5:71794656-71794678 ACATCCCAGATGGGGTGGCCGGG + Intergenic
992433508 5:76732654-76732676 ACAGCACATCTGCCGTGGCCAGG - Exonic
995193969 5:109342942-109342964 ACCTCCCAGTAGGGGTGGCCGGG - Intronic
997433583 5:133858187-133858209 ACCTCCCAGACGGGGTGGCCGGG + Intergenic
999320565 5:150612324-150612346 ACAATACATGTGGGGTGGCCAGG - Intronic
999676381 5:154007370-154007392 TACTCACATGTGGTGTGGCCTGG - Intronic
1000216605 5:159163556-159163578 TCCTCACATCTGTTGTGGTCAGG + Intronic
1002003704 5:176214817-176214839 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1002118522 5:176983916-176983938 ACTTCCCAGATGGGGTGGCCGGG - Intronic
1002118704 5:176984553-176984575 ACCTCCCAGATGGGGCGGCCGGG - Intronic
1002222667 5:177695789-177695811 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1002319577 5:178366912-178366934 ACAGCCCATCTGGTGTGGCCAGG - Intronic
1003635298 6:7826396-7826418 ACCACACACCTGGAGGGGCCTGG + Intronic
1003893380 6:10583750-10583772 ACCTCAAATCTGAGGTTGTCAGG + Intronic
1006231829 6:32594741-32594763 ACCTCCCAGCAGGGGCGGCCGGG + Intergenic
1006326512 6:33357966-33357988 ACCTCCCAGACGGGGTGGCCGGG + Intergenic
1006452852 6:34115086-34115108 ACCTCTCCTCAGGGGTTGCCTGG + Intronic
1007765129 6:44155382-44155404 GGCTCACAGCTGGGGTGGCCTGG + Exonic
1008572089 6:52825738-52825760 ACCTCCCAGATGGGGTGGCCGGG - Intergenic
1008952720 6:57178032-57178054 TCCTCACATCAAGGCTGGCCTGG - Intronic
1008965516 6:57310698-57310720 ACCTCCCAGATGGGGTGGCCGGG + Intergenic
1009392793 6:63164143-63164165 GCCTCCCAGATGGGGTGGCCAGG - Intergenic
1009392848 6:63164327-63164349 ACCTCCCAGATGGGGTGGCCGGG - Intergenic
1009868946 6:69432550-69432572 ACCTCCCAGATGGGGTGGCCGGG + Intergenic
1009868958 6:69432587-69432609 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1009868970 6:69432624-69432646 ACCTCGCAGACGGGGTGGCCAGG + Intergenic
1012479412 6:99650384-99650406 ACTTCTCAGATGGGGTGGCCGGG + Intergenic
1012643784 6:101654702-101654724 ACCTGACATCTTGGGTGGGTGGG - Intronic
1016479857 6:144470259-144470281 ACTTCCCAGATGGGGTGGCCGGG + Intronic
1017536053 6:155349148-155349170 ACCTCCCAACTGGGGTCTCCGGG - Intergenic
1017855743 6:158349199-158349221 ACCTCTCAGACGGGGTGGCCGGG + Intronic
1017855787 6:158349351-158349373 ACCTCTCAGATGGGGCGGCCGGG + Intronic
1017855913 6:158349816-158349838 ACCTCCCAGATGGGGCGGCCGGG + Intronic
1018580003 6:165300665-165300687 ATCCCACATCTTGGGTGACCAGG - Intronic
1019128290 6:169856464-169856486 ACTTCCCAGATGGGGTGGCCTGG + Intergenic
1019128344 6:169856659-169856681 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1019593531 7:1847689-1847711 ACCTCAGCTCTGGGCAGGCCTGG + Exonic
1020219376 7:6223183-6223205 ACCTCCCAGATGGGGCGGCCGGG - Intronic
1022598157 7:31732084-31732106 ACCTCGCATCTGGGCTGTGCGGG - Intergenic
1022629897 7:32075399-32075421 GCCTCACATCTGGTGTGGGCGGG - Intronic
1022757079 7:33304228-33304250 ACATCCCAGATGGGGTGGCCGGG - Intronic
1022757113 7:33304339-33304361 ACCTCCCAGACGGGGTGGCCGGG - Intronic
1024162454 7:46690894-46690916 ACCTCACAAGGGAGGTGGCCTGG + Intronic
1024231387 7:47366610-47366632 GACTCAGGTCTGGGGTGGCCTGG - Intronic
1025321847 7:58102821-58102843 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1025474989 7:60908104-60908126 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1025487910 7:61074887-61074909 AGCTCACATCTGGTTTGTCCTGG - Intergenic
1025512012 7:61581770-61581792 AGCTCACATCTGGTTTGTCCTGG - Intergenic
1025556565 7:62316801-62316823 AGCTCACATCTGGTTTGTCCTGG - Intergenic
1025563358 7:62399470-62399492 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1025566077 7:62435584-62435606 ATCTCACATCTGGTTTGTCCTGG + Intergenic
1026185893 7:68082364-68082386 ACATCCCAGATGGGGTGGCCGGG - Intergenic
1026185915 7:68082440-68082462 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1026186098 7:68083147-68083169 ACATCCCAGATGGGGTGGCCGGG - Intergenic
1026186200 7:68083525-68083547 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1026186212 7:68083562-68083584 ACCTCCCAGATGGGGTGGCCGGG - Intergenic
1028213682 7:88106187-88106209 ACTTCACATCTGGGTTGTACAGG - Intronic
1028535776 7:91888133-91888155 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1029001609 7:97160288-97160310 ACTTCCCAGATGGGGTGGCCGGG - Intronic
1029001631 7:97160362-97160384 ACCTCCCAGATGGGGCGGCCGGG - Intronic
1029821200 7:103149277-103149299 ACCTCGCGCTTGGGGTGGCCGGG + Intronic
1032179554 7:129663518-129663540 ACCTCCCAGACGGGGTGGCCGGG + Intronic
1032256194 7:130298994-130299016 ACATCACAGCTGTGGTGTCCTGG + Intronic
1033185829 7:139226130-139226152 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1033185865 7:139226276-139226298 ACCTCCCAGACGGGGTGGCCAGG - Intergenic
1033185876 7:139226313-139226335 ACCTCCCAGATGGGGCGGCCAGG - Intergenic
1033185908 7:139226424-139226446 ACCTCCCAGATGGGGTGGCAGGG - Intergenic
1033938725 7:146623185-146623207 ACCTCACTTATGTGGTGGCAGGG - Intronic
1034207818 7:149333119-149333141 ACTTCCCAGATGGGGTGGCCGGG + Intergenic
1034881283 7:154764483-154764505 ACCTCACATCTGGGGAGTCTGGG + Intronic
1035848839 8:2894003-2894025 ACCCCACATCTGAGCTAGCCAGG + Intergenic
1036559583 8:9890228-9890250 TCCTCACATCTGGGATGGAGTGG + Intergenic
1036808660 8:11852603-11852625 CACTCACCTCTGGGGTGGCTTGG + Exonic
1039518003 8:38148956-38148978 GCCTTCCATCTGGGGTGGTCAGG + Intronic
1039961968 8:42255117-42255139 ACTTCCCAGATGGGGTGGCCGGG - Intergenic
1040391766 8:46955991-46956013 ACCTCCTATCTGGGCTGTCCTGG + Intergenic
1040916830 8:52573044-52573066 ACCTCCCAGACGGGGTGGCCGGG + Intergenic
1040916879 8:52573228-52573250 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1041070726 8:54125247-54125269 ACTTCTCAGATGGGGTGGCCGGG - Intergenic
1041358129 8:57022211-57022233 ACTTCCCAGCAGGGGTGGCCGGG - Intergenic
1041523125 8:58776547-58776569 ACTTCCCAGATGGGGTGGCCGGG - Intergenic
1041572821 8:59356834-59356856 AGCTCCCATCTGGGATGGGCAGG + Intergenic
1042151880 8:65795810-65795832 ACCTCAAAACTGGGGTGGAGGGG + Intronic
1042535620 8:69855710-69855732 ACTTCCCAGATGGGGTGGCCGGG - Intergenic
1044582026 8:93833834-93833856 ACTTCCCAGGTGGGGTGGCCGGG + Intergenic
1044582112 8:93834092-93834114 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1044582234 8:93834503-93834525 ACCTCCCAGATGGGGTGTCCGGG + Intergenic
1046703576 8:117426845-117426867 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1049317190 8:141975566-141975588 ACCCCTCCTCAGGGGTGGCCGGG - Intergenic
1049481607 8:142827009-142827031 ACCTCCCAGACGGGGTGGCCGGG + Intergenic
1050417892 9:5434325-5434347 ACCTCCCAGACGGGGTGGCCAGG - Intronic
1050417903 9:5434362-5434384 ACCTCCCAAATGGGGCGGCCGGG - Intronic
1051500902 9:17776707-17776729 AATTCTCATCTGTGGTGGCCAGG - Intronic
1052234011 9:26188683-26188705 GCCTGACATATGGGCTGGCCTGG - Intergenic
1052259256 9:26493246-26493268 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1052259313 9:26493433-26493455 ACTTCCCAGATGGGGTGGCCTGG - Intergenic
1052274778 9:26664220-26664242 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1053081647 9:35183116-35183138 ACCTCCCAGACGGGGTGGCCGGG + Intronic
1053081661 9:35183153-35183175 ACCTCCCAGATGGGGCGGCCGGG + Intronic
1053081699 9:35183268-35183290 ACCTCCCAGGCGGGGTGGCCGGG + Intronic
1053715848 9:40886067-40886089 ACTTCCCATATGGGGCGGCCGGG + Intergenic
1053946581 9:43315223-43315245 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1056229267 9:84527114-84527136 ACCTCCCAGGCGGGGTGGCCGGG + Intergenic
1056563996 9:87758114-87758136 ACCTCCCAGTAGGGGTGGCCGGG + Intergenic
1057228291 9:93303992-93304014 ACCTCCCATCATGGGTGCCCTGG - Intronic
1057674744 9:97130270-97130292 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1057751595 9:97796854-97796876 ACCTCCCAGTAGGGGTGGCCGGG - Intergenic
1058049568 9:100392724-100392746 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1058049579 9:100392761-100392783 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1058049737 9:100393327-100393349 ACCTCCCAGATGGGGCGGCCAGG - Intergenic
1058244206 9:102603548-102603570 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1058368267 9:104235226-104235248 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1058368279 9:104235263-104235285 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1058368299 9:104235339-104235361 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1058375420 9:104316549-104316571 ACTTCCCAGATGGGGTGGCCGGG - Intergenic
1058375457 9:104316657-104316679 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1058375522 9:104316878-104316900 ACCTCCCAGATGGGGCGGCCAGG - Intergenic
1061424560 9:130490934-130490956 TCCTCACATCTTCGGGGGCCTGG + Intronic
1061440716 9:130601509-130601531 TCCTCACCACTGGGGTGGCGGGG + Intronic
1062540593 9:137040147-137040169 ACCTCAGCCCTGGGGTGGCAGGG + Intronic
1203589711 Un_KI270747v1:43781-43803 AGCTCACATCTGGTTTGTCCTGG + Intergenic
1186839186 X:13468234-13468256 AAATCACCTCTGGGTTGGCCAGG - Intergenic
1187844575 X:23523116-23523138 AACTCCCAGATGGGGTGGCCCGG - Intergenic
1187844631 X:23523303-23523325 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1188086411 X:25905978-25906000 ACTTCTCAGATGGGGTGGCCGGG - Intergenic
1188214304 X:27458558-27458580 ACCTCCCAGATGGGGCGGCCAGG - Intergenic
1188214429 X:27458977-27458999 ACCTCCCAGATGGGGTGGCTGGG - Intergenic
1189421561 X:40862174-40862196 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1189882046 X:45503852-45503874 ACCTCCCAGAAGGGGTGGCCGGG + Intergenic
1190159126 X:48017276-48017298 ACTTCCCAGATGGGGTGGCCGGG - Intronic
1190174837 X:48139504-48139526 ACTTCCCAGATGGGGTGGCCGGG - Intergenic
1190973115 X:55371836-55371858 ACTTCCCAGATGGGGTGGCCAGG + Intergenic
1192123536 X:68478969-68478991 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1192349920 X:70348960-70348982 ACCTCCCAGATGGGGCGGCCGGG + Intronic
1192349943 X:70349034-70349056 ACCTCCCAGACGGGGTGGCCGGG + Intronic
1192504872 X:71675711-71675733 TCCTCCCAGATGGGGTGGCCGGG - Intergenic
1192505028 X:71676283-71676305 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1192505089 X:71676472-71676494 ACCTCCCAGATGGGGTGGCTGGG - Intergenic
1192663778 X:73068621-73068643 ACCTCCCAGATGGGGTGGCCGGG - Intergenic
1192663909 X:73069029-73069051 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1192663931 X:73069103-73069125 ACCTCCCAGACGGGGTGGCCGGG - Intergenic
1192663955 X:73069174-73069196 ACCTCCCGGATGGGGTGGCCAGG - Intergenic
1192663992 X:73069285-73069307 ACCTCCCGGGTGGGGTGGCCAGG - Intergenic
1192664122 X:73069696-73069718 ACCTCCCAGATGGGGAGGCCAGG - Intergenic
1192885805 X:75335170-75335192 ACCTCCCAGATGGGGTGGCTGGG + Intergenic
1192892762 X:75407647-75407669 ACTTCCCAGATGGGGTGGCCAGG - Intronic
1193514473 X:82446304-82446326 ACCTCCCAACAGGGGTGGACAGG + Intergenic
1195119931 X:101739168-101739190 ACCTCCCAGATGGGGCGGCCGGG - Intergenic
1200209348 X:154339812-154339834 ACCTCTCACCTGGGTTGGTCAGG - Intergenic
1200221528 X:154392315-154392337 ACCTCTCACCTGGGTTGGTCAGG + Intronic
1200247848 X:154535367-154535389 GCTTCTCCTCTGGGGTGGCCTGG + Exonic
1201294618 Y:12453128-12453150 ACCTCCCAGATGGGGCGGCCGGG + Intergenic
1201294709 Y:12453472-12453494 ACCTCCCAGACGGGGTGGCCGGG + Intergenic
1201294810 Y:12453853-12453875 ACCTCCCAGCCAGGGTGGCCGGG + Intergenic
1202028740 Y:20551665-20551687 ACATCACAGATGGGGTGGCTGGG - Intergenic
1202028889 Y:20552198-20552220 ACCTCCCAGACGGGGTGGCCTGG - Intergenic