ID: 967934200

View in Genome Browser
Species Human (GRCh38)
Location 3:194713629-194713651
Sequence CAGGGTAAAACCTCTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967934194_967934200 7 Left 967934194 3:194713599-194713621 CCTCTTAAAAAAATTGGTTTTTA No data
Right 967934200 3:194713629-194713651 CAGGGTAAAACCTCTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967934200 Original CRISPR CAGGGTAAAACCTCTGAAGT GGG Intergenic
No off target data available for this crispr