ID: 967936745

View in Genome Browser
Species Human (GRCh38)
Location 3:194734627-194734649
Sequence ATCCATAAGAAGCAACTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967936742_967936745 22 Left 967936742 3:194734582-194734604 CCCAAAAAAAAGGAAAAAAAGAA 0: 5
1: 72
2: 1080
3: 16964
4: 26953
Right 967936745 3:194734627-194734649 ATCCATAAGAAGCAACTCCCTGG No data
967936744_967936745 -9 Left 967936744 3:194734613-194734635 CCATTTATTTGCTCATCCATAAG No data
Right 967936745 3:194734627-194734649 ATCCATAAGAAGCAACTCCCTGG No data
967936743_967936745 21 Left 967936743 3:194734583-194734605 CCAAAAAAAAGGAAAAAAAGAAA 0: 5
1: 78
2: 989
3: 16840
4: 27639
Right 967936745 3:194734627-194734649 ATCCATAAGAAGCAACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967936745 Original CRISPR ATCCATAAGAAGCAACTCCC TGG Intergenic
No off target data available for this crispr