ID: 967937214

View in Genome Browser
Species Human (GRCh38)
Location 3:194738706-194738728
Sequence CTCTGTTGCCAGCACTGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967937203_967937214 24 Left 967937203 3:194738659-194738681 CCCTGGCAGGGCCCTGGGAGGCA No data
Right 967937214 3:194738706-194738728 CTCTGTTGCCAGCACTGCACAGG No data
967937209_967937214 -7 Left 967937209 3:194738690-194738712 CCAGCCAGTGGCTCCCCTCTGTT No data
Right 967937214 3:194738706-194738728 CTCTGTTGCCAGCACTGCACAGG No data
967937204_967937214 23 Left 967937204 3:194738660-194738682 CCTGGCAGGGCCCTGGGAGGCAG No data
Right 967937214 3:194738706-194738728 CTCTGTTGCCAGCACTGCACAGG No data
967937207_967937214 12 Left 967937207 3:194738671-194738693 CCTGGGAGGCAGCTGGTCTCCAG No data
Right 967937214 3:194738706-194738728 CTCTGTTGCCAGCACTGCACAGG No data
967937201_967937214 28 Left 967937201 3:194738655-194738677 CCAGCCCTGGCAGGGCCCTGGGA No data
Right 967937214 3:194738706-194738728 CTCTGTTGCCAGCACTGCACAGG No data
967937206_967937214 13 Left 967937206 3:194738670-194738692 CCCTGGGAGGCAGCTGGTCTCCA No data
Right 967937214 3:194738706-194738728 CTCTGTTGCCAGCACTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967937214 Original CRISPR CTCTGTTGCCAGCACTGCAC AGG Intergenic
No off target data available for this crispr