ID: 967938013

View in Genome Browser
Species Human (GRCh38)
Location 3:194744750-194744772
Sequence TCCCCAGAGCTCCTAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967938009_967938013 14 Left 967938009 3:194744713-194744735 CCAAGCAACAACTGAGTGTTTCC No data
Right 967938013 3:194744750-194744772 TCCCCAGAGCTCCTAGGGACTGG No data
967938010_967938013 -7 Left 967938010 3:194744734-194744756 CCTGAGCACTATTAGATCCCCAG No data
Right 967938013 3:194744750-194744772 TCCCCAGAGCTCCTAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967938013 Original CRISPR TCCCCAGAGCTCCTAGGGAC TGG Intergenic
No off target data available for this crispr