ID: 967941422

View in Genome Browser
Species Human (GRCh38)
Location 3:194769278-194769300
Sequence ATCAATCATCCAGAAGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967941422_967941429 -10 Left 967941422 3:194769278-194769300 CCCACCCCTTCTGGATGATTGAT No data
Right 967941429 3:194769291-194769313 GATGATTGATTTCTAAGCAGGGG No data
967941422_967941430 8 Left 967941422 3:194769278-194769300 CCCACCCCTTCTGGATGATTGAT No data
Right 967941430 3:194769309-194769331 AGGGGAAGCCCGCTCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967941422 Original CRISPR ATCAATCATCCAGAAGGGGT GGG (reversed) Intergenic
No off target data available for this crispr