ID: 967943045

View in Genome Browser
Species Human (GRCh38)
Location 3:194780908-194780930
Sequence GACTCAAGTCAGCTTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967943045_967943048 2 Left 967943045 3:194780908-194780930 CCAGCCACAAGCTGACTTGAGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 967943048 3:194780933-194780955 AAAGTCACAAAGTGTGACTTGGG 0: 1
1: 0
2: 2
3: 18
4: 275
967943045_967943047 1 Left 967943045 3:194780908-194780930 CCAGCCACAAGCTGACTTGAGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 967943047 3:194780932-194780954 AAAAGTCACAAAGTGTGACTTGG 0: 1
1: 0
2: 1
3: 26
4: 260
967943045_967943051 24 Left 967943045 3:194780908-194780930 CCAGCCACAAGCTGACTTGAGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 967943051 3:194780955-194780977 GGTTTCCTATCCCAGGATCTTGG 0: 1
1: 0
2: 1
3: 13
4: 156
967943045_967943050 17 Left 967943045 3:194780908-194780930 CCAGCCACAAGCTGACTTGAGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 967943050 3:194780948-194780970 GACTTGGGGTTTCCTATCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 114
967943045_967943049 3 Left 967943045 3:194780908-194780930 CCAGCCACAAGCTGACTTGAGTC 0: 1
1: 0
2: 1
3: 4
4: 116
Right 967943049 3:194780934-194780956 AAGTCACAAAGTGTGACTTGGGG 0: 1
1: 0
2: 5
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967943045 Original CRISPR GACTCAAGTCAGCTTGTGGC TGG (reversed) Intergenic
902517978 1:17000106-17000128 GACTCCAGTGAGCTAGTGCCCGG - Exonic
906096275 1:43226311-43226333 GACTCAAAACAGCTGGAGGCTGG + Intronic
912089552 1:106054575-106054597 GAAACAAGTCAGTATGTGGCTGG + Intergenic
912543591 1:110434987-110435009 GACTCCAGTCAGCTGGTGAAGGG + Intergenic
913647297 1:120870669-120870691 GACTCAAGTCTCCCAGTGGCTGG - Intergenic
914079346 1:144392190-144392212 GACTCAAGTCTCCCAGTGGCTGG + Intergenic
914099833 1:144574312-144574334 GACTCAAGTCTCCCAGTGGCTGG - Intergenic
914174247 1:145260736-145260758 GACTCAAGTCTCCCAGTGGCTGG + Intergenic
914299154 1:146363369-146363391 GACTCAAGTCTCCCAGTGGCTGG + Intergenic
914528911 1:148501920-148501942 GACTCAAGTCTCCCAGTGGCTGG + Intergenic
914637482 1:149565188-149565210 GACTCAAGTCTCCCAGTGGCTGG - Intergenic
915561391 1:156690174-156690196 CACTCAACTCAGCTGCTGGCTGG - Intergenic
919604664 1:199667236-199667258 CACTCATGTGAGCTCGTGGCTGG - Intergenic
919643465 1:200067610-200067632 GACACGAGTCTGCTTGGGGCTGG + Intronic
920176807 1:204107252-204107274 CATACAAGTCAGCCTGTGGCAGG + Intronic
922284972 1:224162917-224162939 GTCTAAAGTCACCTTCTGGCCGG + Intergenic
922731885 1:227952770-227952792 CACTCAAGTCACCATGTGGCTGG + Intergenic
923737994 1:236630114-236630136 GACTGAATTCAGCAGGTGGCTGG - Intergenic
924510447 1:244725311-244725333 GGATCTAGCCAGCTTGTGGCTGG - Intergenic
1063205037 10:3822813-3822835 AACTCAAGTCAGCTTCCCGCTGG - Intergenic
1065571158 10:27072200-27072222 GATTCCAGTCAGCTTGTGCTTGG - Intronic
1071320801 10:84455110-84455132 GACTCACATCTGCATGTGGCTGG - Intronic
1073511203 10:104043640-104043662 GACCCAAGCCAGGTTGTGGTGGG + Intronic
1074300338 10:112227446-112227468 GAACCAAGACAGCTTATGGCTGG - Intergenic
1078489268 11:11754292-11754314 GACTGAAGTCACCTCGTGGAGGG - Intergenic
1080288305 11:30641456-30641478 AATTCAAGACAGTTTGTGGCGGG - Intergenic
1083417362 11:62534363-62534385 GATTCAAATCAGCCTGTGCCAGG + Intronic
1084601448 11:70148132-70148154 AACTGAAGGCAGCGTGTGGCAGG - Intronic
1086160742 11:83719298-83719320 CACTCAAGTCACATAGTGGCAGG - Intronic
1086886190 11:92208616-92208638 GACAGAAGACAGCTTGTTGCTGG - Intergenic
1087321170 11:96660639-96660661 GTCTCAACGCAGCTTATGGCTGG - Intergenic
1087388742 11:97507749-97507771 TACTCAAGTCAGGTTGTTACAGG - Intergenic
1088364974 11:109031081-109031103 GACACAAGTCTGGATGTGGCTGG + Intergenic
1089265416 11:117256431-117256453 GGCTCCGGTCAGGTTGTGGCTGG + Intronic
1100875133 12:98953734-98953756 AACTGGAGTCAGCTTGTGGGAGG - Intronic
1101377649 12:104184660-104184682 GCCTGAAGTCAGCCTGTGGTGGG - Intergenic
1101909011 12:108848911-108848933 GACTCATGCCAACTGGTGGCAGG - Intronic
1102623501 12:114215930-114215952 GACTCAAATCAGCAAGTTGCTGG + Intergenic
1103081450 12:118027127-118027149 GACTCTGGTCAGCTTGTTGTGGG + Intronic
1104304336 12:127595710-127595732 CACTCAAGACAGCTGGTGGGTGG + Intergenic
1119899496 14:78247932-78247954 GCATGAAGTCAGCCTGTGGCAGG + Intronic
1120295645 14:82636860-82636882 GACTCAATTCAGTTTGTGAGGGG + Intergenic
1125269576 15:37922662-37922684 GAATCCAGTCAGCTTGTGCTAGG - Intronic
1132732076 16:1367527-1367549 GACTCAGGTGAGCGTGTGGGGGG - Intronic
1132981548 16:2740764-2740786 GACTCAAGTCAGAGTGTGTGGGG - Intergenic
1133030809 16:3010152-3010174 GACTCAGGGAATCTTGTGGCAGG - Intergenic
1137472612 16:48775420-48775442 GACTCAAGTTTCCATGTGGCTGG + Intergenic
1138156525 16:54710134-54710156 TGCTCAAGTCAGGTTGTAGCAGG + Intergenic
1138424531 16:56921972-56921994 GTCTGAAGTCAGCTTGGGGAAGG + Intergenic
1139654360 16:68378314-68378336 AACTTAAGTCAACTCGTGGCTGG + Intronic
1144620581 17:16816005-16816027 GACCTGAGTCAGCATGTGGCTGG + Intergenic
1144885061 17:18452142-18452164 GACCTGAGTCAGCATGTGGCTGG - Intergenic
1145147158 17:20492235-20492257 GACCTGAGTCAGCATGTGGCTGG + Intergenic
1145877601 17:28331413-28331435 TACTGAAGTCATCTTTTGGCTGG - Intronic
1150862052 17:68810588-68810610 GTCTCTAGACAGCTTGTGACCGG + Intergenic
1151231193 17:72686361-72686383 GACCCCAGTCAGCTTCTGGAAGG - Intronic
1153472666 18:5464286-5464308 GTCCCCAGTCACCTTGTGGCAGG - Intronic
1154311922 18:13273625-13273647 GACTCACTCCAGCTGGTGGCTGG - Intronic
1160096776 18:75880495-75880517 GGCTTCAGTCAGCTGGTGGCTGG - Intergenic
1161488458 19:4548427-4548449 CACTCGAGTCAGCTGGTGCCTGG + Exonic
1164087526 19:21917287-21917309 GATTCAAGTCATCTTGGTGCTGG - Intergenic
1164242518 19:23402381-23402403 GACTCATGCCACCTTGTTGCTGG + Intergenic
1164312285 19:24056552-24056574 GACTCATGTCACCATGTTGCTGG - Intronic
1164877624 19:31702720-31702742 GACTACAGTCAGATGGTGGCTGG + Intergenic
1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG + Intronic
931654885 2:64501991-64502013 GACTGAGATCAGCTTGTGGAAGG - Intergenic
933694614 2:85208348-85208370 CTCTCAAGTCACCTTCTGGCAGG + Intronic
938296667 2:130183071-130183093 GAATCAAGACAGTTTGGGGCTGG + Intronic
942850186 2:180474963-180474985 GAGACAAGGCTGCTTGTGGCAGG - Intergenic
944518073 2:200532202-200532224 GACTCAAGGCAGGTAGTGGTGGG + Intronic
947974643 2:234355226-234355248 GACTCGAGACAGCCTGGGGCCGG + Intergenic
948513913 2:238490991-238491013 TACACAAGCCAGCTGGTGGCTGG + Intergenic
1173381067 20:42542092-42542114 GACACAACTTACCTTGTGGCAGG - Intronic
1173579710 20:44138356-44138378 GACTCAAGGCTGCTTGCTGCTGG - Intronic
1176264079 20:64199527-64199549 GATAGAAGTCAGCTTTTGGCAGG - Intronic
1178083434 21:29089567-29089589 GACACCATTAAGCTTGTGGCTGG + Intronic
1179088079 21:38238101-38238123 GGCTGAAGTCACCTGGTGGCAGG + Intronic
1179807469 21:43848929-43848951 GTCTGAAGTCAGCTGGAGGCCGG + Intergenic
1180204617 21:46250632-46250654 CACTCTAGTGAGCTTGTGTCAGG - Intronic
1185110022 22:48895578-48895600 GACACAGGTCAGGATGTGGCAGG + Intergenic
950435971 3:12980310-12980332 GAGCCAAGTCAGCCTTTGGCTGG + Intronic
950723990 3:14904126-14904148 GGCTGAAGTCACCTGGTGGCAGG + Intronic
956320193 3:67987986-67988008 GACTCATCACAGCTGGTGGCTGG + Intergenic
962265940 3:133944402-133944424 GACTCAAGTCAGTTTGCTGCTGG + Intronic
962377503 3:134870680-134870702 GAGTCTATTCAGCCTGTGGCTGG - Intronic
967943045 3:194780908-194780930 GACTCAAGTCAGCTTGTGGCTGG - Intergenic
969443232 4:7229312-7229334 GGCTCCTGTCAGCTGGTGGCAGG - Intronic
969707161 4:8818316-8818338 GCCTCAATTCAGCCTGTGTCTGG + Intergenic
970039585 4:11780887-11780909 GACACAATTCAGCTTGTCACGGG + Intergenic
972793112 4:42391820-42391842 GATTCAAATCAGCTGGTGGTGGG + Intergenic
976294705 4:83458492-83458514 GAATCAAGTCAGTTTATAGCAGG + Intronic
980686113 4:136231358-136231380 GACTCAATTCAGCTGGTAACAGG - Intergenic
981281255 4:142962166-142962188 GTCCCAGGTCAGCTTGTGGAGGG + Intergenic
982313240 4:154006757-154006779 GACTCTAGATAGCTTCTGGCTGG + Intergenic
986257514 5:6112705-6112727 CACTCAAGTAAACTTGTGGTTGG - Intergenic
986715862 5:10523180-10523202 CACTCAAGCAAGGTTGTGGCAGG + Intergenic
989978567 5:50614060-50614082 GACTCAAGTCTCCCAGTGGCTGG - Intergenic
991203385 5:64020366-64020388 GAATCCAGTCATCTTGTTGCTGG + Intergenic
992776523 5:80093899-80093921 GACTCAACCCCTCTTGTGGCAGG + Intergenic
1003294703 6:4814866-4814888 GATTCATGTCAGCTTGTTGTAGG + Intronic
1006672754 6:35739751-35739773 TCCTGAAGTGAGCTTGTGGCAGG - Intronic
1008651961 6:53573079-53573101 AACTCCAGTCAGCATCTGGCCGG - Intronic
1022289439 7:28986793-28986815 GGCTGGAGTCAGTTTGTGGCAGG + Intergenic
1022499735 7:30875105-30875127 GACTCAATGCAGGATGTGGCTGG - Intronic
1026551565 7:71373352-71373374 GACTCAGGTCAGCTGGTGAAGGG + Intronic
1027556170 7:79667245-79667267 GACTCAAGGCTGCTTGTGCATGG - Intergenic
1031671063 7:124546333-124546355 GCTTCAAGTCAGTGTGTGGCAGG + Intergenic
1034885425 7:154794821-154794843 GAAGCAGGTCACCTTGTGGCGGG + Intronic
1038345814 8:26731515-26731537 GACTGAGGTCAGATTGTGGAGGG + Intergenic
1038612319 8:29068403-29068425 GACTAATGTCAGCTTGTGGCTGG - Exonic
1041296523 8:56362671-56362693 GTCTCACAGCAGCTTGTGGCAGG + Intergenic
1041343986 8:56876576-56876598 GTCTCAACTCAGCTTCTGACTGG + Intergenic
1045815014 8:106269591-106269613 GACCCAAGGCAGCTTGGAGCGGG - Intergenic
1048305347 8:133280053-133280075 CACTCAAGTCAGCTTCTGTCTGG + Intronic
1053173614 9:35907519-35907541 GATTCAAGGCAGCCTGTGGATGG - Intergenic
1055717977 9:79139361-79139383 GACTCAACTCAGCCTCTGGCTGG - Intergenic
1058744546 9:107976922-107976944 GACTCCAGCCAGCTGTTGGCAGG + Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1186090003 X:6036586-6036608 GAATAAACCCAGCTTGTGGCTGG + Intronic
1188264596 X:28056257-28056279 GATTCAAGTCAGGTTGTAGGGGG - Intergenic
1197459829 X:126726714-126726736 ATCTCAAGTCAGCTTGAGGGTGG - Intergenic
1200097502 X:153671062-153671084 GAATCAGGTGAGCTTGAGGCTGG - Exonic