ID: 967948307

View in Genome Browser
Species Human (GRCh38)
Location 3:194821272-194821294
Sequence CAGTATCACTTTCTCAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967948305_967948307 -4 Left 967948305 3:194821253-194821275 CCCTCGAAGACAGGAGGGACAGT No data
Right 967948307 3:194821272-194821294 CAGTATCACTTTCTCAACCAAGG No data
967948306_967948307 -5 Left 967948306 3:194821254-194821276 CCTCGAAGACAGGAGGGACAGTA No data
Right 967948307 3:194821272-194821294 CAGTATCACTTTCTCAACCAAGG No data
967948301_967948307 8 Left 967948301 3:194821241-194821263 CCTTCTCACTGTCCCTCGAAGAC No data
Right 967948307 3:194821272-194821294 CAGTATCACTTTCTCAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967948307 Original CRISPR CAGTATCACTTTCTCAACCA AGG Intergenic
No off target data available for this crispr