ID: 967948419

View in Genome Browser
Species Human (GRCh38)
Location 3:194822365-194822387
Sequence CCGTGTCCTGGCCCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967948419_967948430 23 Left 967948419 3:194822365-194822387 CCAGCAGCAGGGCCAGGACACGG No data
Right 967948430 3:194822411-194822433 TAGCTGTGGGGCTGCAGGTCAGG No data
967948419_967948431 24 Left 967948419 3:194822365-194822387 CCAGCAGCAGGGCCAGGACACGG No data
Right 967948431 3:194822412-194822434 AGCTGTGGGGCTGCAGGTCAGGG No data
967948419_967948428 11 Left 967948419 3:194822365-194822387 CCAGCAGCAGGGCCAGGACACGG No data
Right 967948428 3:194822399-194822421 GAGAAAGAGGGCTAGCTGTGGGG No data
967948419_967948424 -2 Left 967948419 3:194822365-194822387 CCAGCAGCAGGGCCAGGACACGG No data
Right 967948424 3:194822386-194822408 GGAAGGCTGGCATGAGAAAGAGG No data
967948419_967948427 10 Left 967948419 3:194822365-194822387 CCAGCAGCAGGGCCAGGACACGG No data
Right 967948427 3:194822398-194822420 TGAGAAAGAGGGCTAGCTGTGGG No data
967948419_967948425 -1 Left 967948419 3:194822365-194822387 CCAGCAGCAGGGCCAGGACACGG No data
Right 967948425 3:194822387-194822409 GAAGGCTGGCATGAGAAAGAGGG No data
967948419_967948429 18 Left 967948419 3:194822365-194822387 CCAGCAGCAGGGCCAGGACACGG No data
Right 967948429 3:194822406-194822428 AGGGCTAGCTGTGGGGCTGCAGG No data
967948419_967948432 25 Left 967948419 3:194822365-194822387 CCAGCAGCAGGGCCAGGACACGG No data
Right 967948432 3:194822413-194822435 GCTGTGGGGCTGCAGGTCAGGGG No data
967948419_967948426 9 Left 967948419 3:194822365-194822387 CCAGCAGCAGGGCCAGGACACGG No data
Right 967948426 3:194822397-194822419 ATGAGAAAGAGGGCTAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967948419 Original CRISPR CCGTGTCCTGGCCCTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr