ID: 967949738

View in Genome Browser
Species Human (GRCh38)
Location 3:194831653-194831675
Sequence GCCAAGTTCCTCACTGCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967949738_967949745 18 Left 967949738 3:194831653-194831675 CCTAAGGCAGTGAGGAACTTGGC No data
Right 967949745 3:194831694-194831716 GAGAGGACAGTGTGTCTAGAGGG No data
967949738_967949747 25 Left 967949738 3:194831653-194831675 CCTAAGGCAGTGAGGAACTTGGC No data
Right 967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG No data
967949738_967949741 -9 Left 967949738 3:194831653-194831675 CCTAAGGCAGTGAGGAACTTGGC No data
Right 967949741 3:194831667-194831689 GAACTTGGCTCTGGGAGAAATGG No data
967949738_967949742 -4 Left 967949738 3:194831653-194831675 CCTAAGGCAGTGAGGAACTTGGC No data
Right 967949742 3:194831672-194831694 TGGCTCTGGGAGAAATGGAAAGG No data
967949738_967949743 1 Left 967949738 3:194831653-194831675 CCTAAGGCAGTGAGGAACTTGGC No data
Right 967949743 3:194831677-194831699 CTGGGAGAAATGGAAAGGAGAGG No data
967949738_967949746 21 Left 967949738 3:194831653-194831675 CCTAAGGCAGTGAGGAACTTGGC No data
Right 967949746 3:194831697-194831719 AGGACAGTGTGTCTAGAGGGTGG No data
967949738_967949744 17 Left 967949738 3:194831653-194831675 CCTAAGGCAGTGAGGAACTTGGC No data
Right 967949744 3:194831693-194831715 GGAGAGGACAGTGTGTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967949738 Original CRISPR GCCAAGTTCCTCACTGCCTT AGG (reversed) Intergenic
No off target data available for this crispr