ID: 967949747

View in Genome Browser
Species Human (GRCh38)
Location 3:194831701-194831723
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967949738_967949747 25 Left 967949738 3:194831653-194831675 CCTAAGGCAGTGAGGAACTTGGC No data
Right 967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr