ID: 967951129

View in Genome Browser
Species Human (GRCh38)
Location 3:194841596-194841618
Sequence GTGGTAACCCTGCTACTGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967951126_967951129 -7 Left 967951126 3:194841580-194841602 CCTTTGGCTAAGCCCTGTGGTAA No data
Right 967951129 3:194841596-194841618 GTGGTAACCCTGCTACTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967951129 Original CRISPR GTGGTAACCCTGCTACTGTG CGG Intergenic
No off target data available for this crispr