ID: 967951944

View in Genome Browser
Species Human (GRCh38)
Location 3:194847996-194848018
Sequence GTGGAGTGAAGGGCTTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967951944_967951951 3 Left 967951944 3:194847996-194848018 CCTTTTAAAGCCCTTCACTCCAC No data
Right 967951951 3:194848022-194848044 CCACACACAGCCTGGCCTGCAGG No data
967951944_967951954 19 Left 967951944 3:194847996-194848018 CCTTTTAAAGCCCTTCACTCCAC No data
Right 967951954 3:194848038-194848060 CTGCAGGAAGTGTTTACCCAAGG No data
967951944_967951948 -5 Left 967951944 3:194847996-194848018 CCTTTTAAAGCCCTTCACTCCAC No data
Right 967951948 3:194848014-194848036 TCCACAGGCCACACACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967951944 Original CRISPR GTGGAGTGAAGGGCTTTAAA AGG (reversed) Intergenic
No off target data available for this crispr