ID: 967953574

View in Genome Browser
Species Human (GRCh38)
Location 3:194859724-194859746
Sequence CTATAGGAAATATGAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967953574_967953579 12 Left 967953574 3:194859724-194859746 CCCATTTCTCATATTTCCTATAG No data
Right 967953579 3:194859759-194859781 TGCTGGGAGTCTTGAAGCCTTGG No data
967953574_967953577 -5 Left 967953574 3:194859724-194859746 CCCATTTCTCATATTTCCTATAG No data
Right 967953577 3:194859742-194859764 TATAGTTCAGACATTTGTGCTGG No data
967953574_967953580 20 Left 967953574 3:194859724-194859746 CCCATTTCTCATATTTCCTATAG No data
Right 967953580 3:194859767-194859789 GTCTTGAAGCCTTGGACTCCCGG No data
967953574_967953578 -4 Left 967953574 3:194859724-194859746 CCCATTTCTCATATTTCCTATAG No data
Right 967953578 3:194859743-194859765 ATAGTTCAGACATTTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967953574 Original CRISPR CTATAGGAAATATGAGAAAT GGG (reversed) Intergenic
No off target data available for this crispr