ID: 967953760

View in Genome Browser
Species Human (GRCh38)
Location 3:194861120-194861142
Sequence CACTTTGTGAAGAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967953760_967953764 3 Left 967953760 3:194861120-194861142 CCCAGCTCCCTCTTCACAAAGTG No data
Right 967953764 3:194861146-194861168 ATACTCATGCCTGCATCATGAGG No data
967953760_967953767 13 Left 967953760 3:194861120-194861142 CCCAGCTCCCTCTTCACAAAGTG No data
Right 967953767 3:194861156-194861178 CTGCATCATGAGGTTGCTGTGGG No data
967953760_967953768 14 Left 967953760 3:194861120-194861142 CCCAGCTCCCTCTTCACAAAGTG No data
Right 967953768 3:194861157-194861179 TGCATCATGAGGTTGCTGTGGGG No data
967953760_967953766 12 Left 967953760 3:194861120-194861142 CCCAGCTCCCTCTTCACAAAGTG No data
Right 967953766 3:194861155-194861177 CCTGCATCATGAGGTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967953760 Original CRISPR CACTTTGTGAAGAGGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr