ID: 967953768

View in Genome Browser
Species Human (GRCh38)
Location 3:194861157-194861179
Sequence TGCATCATGAGGTTGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967953761_967953768 13 Left 967953761 3:194861121-194861143 CCAGCTCCCTCTTCACAAAGTGA No data
Right 967953768 3:194861157-194861179 TGCATCATGAGGTTGCTGTGGGG No data
967953762_967953768 7 Left 967953762 3:194861127-194861149 CCCTCTTCACAAAGTGAAGATAC No data
Right 967953768 3:194861157-194861179 TGCATCATGAGGTTGCTGTGGGG No data
967953760_967953768 14 Left 967953760 3:194861120-194861142 CCCAGCTCCCTCTTCACAAAGTG No data
Right 967953768 3:194861157-194861179 TGCATCATGAGGTTGCTGTGGGG No data
967953763_967953768 6 Left 967953763 3:194861128-194861150 CCTCTTCACAAAGTGAAGATACT No data
Right 967953768 3:194861157-194861179 TGCATCATGAGGTTGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967953768 Original CRISPR TGCATCATGAGGTTGCTGTG GGG Intergenic
No off target data available for this crispr