ID: 967957911

View in Genome Browser
Species Human (GRCh38)
Location 3:194892087-194892109
Sequence GTTCTCACCAGAATAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967957905_967957911 24 Left 967957905 3:194892040-194892062 CCTACTCTACATAGTGGGTGCTG No data
Right 967957911 3:194892087-194892109 GTTCTCACCAGAATAAAAAGAGG No data
967957903_967957911 26 Left 967957903 3:194892038-194892060 CCCCTACTCTACATAGTGGGTGC No data
Right 967957911 3:194892087-194892109 GTTCTCACCAGAATAAAAAGAGG No data
967957907_967957911 1 Left 967957907 3:194892063-194892085 CCCTCTGAAAAAGACTAGAGGCG No data
Right 967957911 3:194892087-194892109 GTTCTCACCAGAATAAAAAGAGG No data
967957900_967957911 30 Left 967957900 3:194892034-194892056 CCTTCCCCTACTCTACATAGTGG No data
Right 967957911 3:194892087-194892109 GTTCTCACCAGAATAAAAAGAGG No data
967957904_967957911 25 Left 967957904 3:194892039-194892061 CCCTACTCTACATAGTGGGTGCT No data
Right 967957911 3:194892087-194892109 GTTCTCACCAGAATAAAAAGAGG No data
967957908_967957911 0 Left 967957908 3:194892064-194892086 CCTCTGAAAAAGACTAGAGGCGG No data
Right 967957911 3:194892087-194892109 GTTCTCACCAGAATAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967957911 Original CRISPR GTTCTCACCAGAATAAAAAG AGG Intergenic
No off target data available for this crispr