ID: 967959386

View in Genome Browser
Species Human (GRCh38)
Location 3:194908261-194908283
Sequence CAAGCCCCTGCAGCTGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967959386_967959389 21 Left 967959386 3:194908261-194908283 CCTGTGGCAGCTGCAGGGGCTTG No data
Right 967959389 3:194908305-194908327 ATGTTACTATAGATGGAGCTAGG No data
967959386_967959388 14 Left 967959386 3:194908261-194908283 CCTGTGGCAGCTGCAGGGGCTTG No data
Right 967959388 3:194908298-194908320 AGTACTCATGTTACTATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967959386 Original CRISPR CAAGCCCCTGCAGCTGCCAC AGG (reversed) Intergenic
No off target data available for this crispr