ID: 967959387

View in Genome Browser
Species Human (GRCh38)
Location 3:194908288-194908310
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967959387_967959389 -6 Left 967959387 3:194908288-194908310 CCTTAGCTCTAGTACTCATGTTA No data
Right 967959389 3:194908305-194908327 ATGTTACTATAGATGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967959387 Original CRISPR TAACATGAGTACTAGAGCTA AGG (reversed) Intergenic
No off target data available for this crispr