ID: 967959389

View in Genome Browser
Species Human (GRCh38)
Location 3:194908305-194908327
Sequence ATGTTACTATAGATGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967959387_967959389 -6 Left 967959387 3:194908288-194908310 CCTTAGCTCTAGTACTCATGTTA No data
Right 967959389 3:194908305-194908327 ATGTTACTATAGATGGAGCTAGG No data
967959386_967959389 21 Left 967959386 3:194908261-194908283 CCTGTGGCAGCTGCAGGGGCTTG No data
Right 967959389 3:194908305-194908327 ATGTTACTATAGATGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967959389 Original CRISPR ATGTTACTATAGATGGAGCT AGG Intergenic
No off target data available for this crispr