ID: 967960103

View in Genome Browser
Species Human (GRCh38)
Location 3:194913571-194913593
Sequence CTTGCCAGTGATTGGCCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967960103_967960108 -8 Left 967960103 3:194913571-194913593 CCCATTGGCCAATCACTGGCAAG No data
Right 967960108 3:194913586-194913608 CTGGCAAGAAGATGTGGTCTGGG No data
967960103_967960107 -9 Left 967960103 3:194913571-194913593 CCCATTGGCCAATCACTGGCAAG No data
Right 967960107 3:194913585-194913607 ACTGGCAAGAAGATGTGGTCTGG No data
967960103_967960109 30 Left 967960103 3:194913571-194913593 CCCATTGGCCAATCACTGGCAAG No data
Right 967960109 3:194913624-194913646 TCCTCCCCAAGTCACATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967960103 Original CRISPR CTTGCCAGTGATTGGCCAAT GGG (reversed) Intergenic
No off target data available for this crispr