ID: 967960104

View in Genome Browser
Species Human (GRCh38)
Location 3:194913572-194913594
Sequence TCTTGCCAGTGATTGGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967960104_967960109 29 Left 967960104 3:194913572-194913594 CCATTGGCCAATCACTGGCAAGA No data
Right 967960109 3:194913624-194913646 TCCTCCCCAAGTCACATGAAAGG No data
967960104_967960107 -10 Left 967960104 3:194913572-194913594 CCATTGGCCAATCACTGGCAAGA No data
Right 967960107 3:194913585-194913607 ACTGGCAAGAAGATGTGGTCTGG No data
967960104_967960108 -9 Left 967960104 3:194913572-194913594 CCATTGGCCAATCACTGGCAAGA No data
Right 967960108 3:194913586-194913608 CTGGCAAGAAGATGTGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967960104 Original CRISPR TCTTGCCAGTGATTGGCCAA TGG (reversed) Intergenic
No off target data available for this crispr