ID: 967960105 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:194913579-194913601 |
| Sequence | CACATCTTCTTGCCAGTGAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 967960105_967960109 | 22 | Left | 967960105 | 3:194913579-194913601 | CCAATCACTGGCAAGAAGATGTG | No data | ||
| Right | 967960109 | 3:194913624-194913646 | TCCTCCCCAAGTCACATGAAAGG | No data | ||||
| 967960105_967960114 | 29 | Left | 967960105 | 3:194913579-194913601 | CCAATCACTGGCAAGAAGATGTG | No data | ||
| Right | 967960114 | 3:194913631-194913653 | CAAGTCACATGAAAGGAAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 967960105 | Original CRISPR | CACATCTTCTTGCCAGTGAT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||