ID: 967960105

View in Genome Browser
Species Human (GRCh38)
Location 3:194913579-194913601
Sequence CACATCTTCTTGCCAGTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967960105_967960109 22 Left 967960105 3:194913579-194913601 CCAATCACTGGCAAGAAGATGTG No data
Right 967960109 3:194913624-194913646 TCCTCCCCAAGTCACATGAAAGG No data
967960105_967960114 29 Left 967960105 3:194913579-194913601 CCAATCACTGGCAAGAAGATGTG No data
Right 967960114 3:194913631-194913653 CAAGTCACATGAAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967960105 Original CRISPR CACATCTTCTTGCCAGTGAT TGG (reversed) Intergenic
No off target data available for this crispr