ID: 967960109

View in Genome Browser
Species Human (GRCh38)
Location 3:194913624-194913646
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967960103_967960109 30 Left 967960103 3:194913571-194913593 CCCATTGGCCAATCACTGGCAAG No data
Right 967960109 3:194913624-194913646 TCCTCCCCAAGTCACATGAAAGG No data
967960105_967960109 22 Left 967960105 3:194913579-194913601 CCAATCACTGGCAAGAAGATGTG No data
Right 967960109 3:194913624-194913646 TCCTCCCCAAGTCACATGAAAGG No data
967960104_967960109 29 Left 967960104 3:194913572-194913594 CCATTGGCCAATCACTGGCAAGA No data
Right 967960109 3:194913624-194913646 TCCTCCCCAAGTCACATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type