ID: 967960114

View in Genome Browser
Species Human (GRCh38)
Location 3:194913631-194913653
Sequence CAAGTCACATGAAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967960105_967960114 29 Left 967960105 3:194913579-194913601 CCAATCACTGGCAAGAAGATGTG No data
Right 967960114 3:194913631-194913653 CAAGTCACATGAAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967960114 Original CRISPR CAAGTCACATGAAAGGAAGA AGG Intergenic