ID: 967962138

View in Genome Browser
Species Human (GRCh38)
Location 3:194933902-194933924
Sequence CTGTGAAGAGGGGAGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967962131_967962138 -4 Left 967962131 3:194933883-194933905 CCCGCAGACATCATCGGTGCTGT No data
Right 967962138 3:194933902-194933924 CTGTGAAGAGGGGAGCTGGGAGG No data
967962125_967962138 20 Left 967962125 3:194933859-194933881 CCCCCTGTCTATTTGAATTTCAG No data
Right 967962138 3:194933902-194933924 CTGTGAAGAGGGGAGCTGGGAGG No data
967962128_967962138 18 Left 967962128 3:194933861-194933883 CCCTGTCTATTTGAATTTCAGGC No data
Right 967962138 3:194933902-194933924 CTGTGAAGAGGGGAGCTGGGAGG No data
967962126_967962138 19 Left 967962126 3:194933860-194933882 CCCCTGTCTATTTGAATTTCAGG No data
Right 967962138 3:194933902-194933924 CTGTGAAGAGGGGAGCTGGGAGG No data
967962129_967962138 17 Left 967962129 3:194933862-194933884 CCTGTCTATTTGAATTTCAGGCC No data
Right 967962138 3:194933902-194933924 CTGTGAAGAGGGGAGCTGGGAGG No data
967962132_967962138 -5 Left 967962132 3:194933884-194933906 CCGCAGACATCATCGGTGCTGTG No data
Right 967962138 3:194933902-194933924 CTGTGAAGAGGGGAGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967962138 Original CRISPR CTGTGAAGAGGGGAGCTGGG AGG Intergenic
No off target data available for this crispr