ID: 967965614

View in Genome Browser
Species Human (GRCh38)
Location 3:194957861-194957883
Sequence CTGTCTTTGCAGTTGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967965608_967965614 25 Left 967965608 3:194957813-194957835 CCTGAAGTTAAATCACTCTCCTG No data
Right 967965614 3:194957861-194957883 CTGTCTTTGCAGTTGATGGAAGG No data
967965610_967965614 6 Left 967965610 3:194957832-194957854 CCTGTTTACTCAGAGGAACGCTG No data
Right 967965614 3:194957861-194957883 CTGTCTTTGCAGTTGATGGAAGG No data
967965607_967965614 26 Left 967965607 3:194957812-194957834 CCCTGAAGTTAAATCACTCTCCT No data
Right 967965614 3:194957861-194957883 CTGTCTTTGCAGTTGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967965614 Original CRISPR CTGTCTTTGCAGTTGATGGA AGG Intergenic
No off target data available for this crispr