ID: 967965753

View in Genome Browser
Species Human (GRCh38)
Location 3:194959042-194959064
Sequence GTCAAGGGATGCAGGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967965748_967965753 8 Left 967965748 3:194959011-194959033 CCTAGAAAATGATTAATAACTCA No data
Right 967965753 3:194959042-194959064 GTCAAGGGATGCAGGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967965753 Original CRISPR GTCAAGGGATGCAGGCTCCC AGG Intergenic
No off target data available for this crispr