ID: 967969559

View in Genome Browser
Species Human (GRCh38)
Location 3:194988976-194988998
Sequence CCCATAAGGAATGCTGGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967969559_967969568 4 Left 967969559 3:194988976-194988998 CCAACGCCAGCATTCCTTATGGG No data
Right 967969568 3:194989003-194989025 CTATTCGTCACATGGGGACCAGG No data
967969559_967969571 29 Left 967969559 3:194988976-194988998 CCAACGCCAGCATTCCTTATGGG No data
Right 967969571 3:194989028-194989050 CTCAGGTTCATCATTTCCTGTGG No data
967969559_967969566 -3 Left 967969559 3:194988976-194988998 CCAACGCCAGCATTCCTTATGGG No data
Right 967969566 3:194988996-194989018 GGGTGGGCTATTCGTCACATGGG No data
967969559_967969567 -2 Left 967969559 3:194988976-194988998 CCAACGCCAGCATTCCTTATGGG No data
Right 967969567 3:194988997-194989019 GGTGGGCTATTCGTCACATGGGG No data
967969559_967969565 -4 Left 967969559 3:194988976-194988998 CCAACGCCAGCATTCCTTATGGG No data
Right 967969565 3:194988995-194989017 TGGGTGGGCTATTCGTCACATGG No data
967969559_967969569 12 Left 967969559 3:194988976-194988998 CCAACGCCAGCATTCCTTATGGG No data
Right 967969569 3:194989011-194989033 CACATGGGGACCAGGAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967969559 Original CRISPR CCCATAAGGAATGCTGGCGT TGG (reversed) Intergenic
No off target data available for this crispr