ID: 967969780

View in Genome Browser
Species Human (GRCh38)
Location 3:194990454-194990476
Sequence GTTCTTCGATTGAACACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967969780_967969786 12 Left 967969780 3:194990454-194990476 CCTCTGGTGTTCAATCGAAGAAC No data
Right 967969786 3:194990489-194990511 TGCTGGAGGAAAATCTGGCCGGG No data
967969780_967969781 -5 Left 967969780 3:194990454-194990476 CCTCTGGTGTTCAATCGAAGAAC No data
Right 967969781 3:194990472-194990494 AGAACTAACGATTCCAGTGCTGG No data
967969780_967969783 7 Left 967969780 3:194990454-194990476 CCTCTGGTGTTCAATCGAAGAAC No data
Right 967969783 3:194990484-194990506 TCCAGTGCTGGAGGAAAATCTGG No data
967969780_967969785 11 Left 967969780 3:194990454-194990476 CCTCTGGTGTTCAATCGAAGAAC No data
Right 967969785 3:194990488-194990510 GTGCTGGAGGAAAATCTGGCCGG No data
967969780_967969782 -2 Left 967969780 3:194990454-194990476 CCTCTGGTGTTCAATCGAAGAAC No data
Right 967969782 3:194990475-194990497 ACTAACGATTCCAGTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967969780 Original CRISPR GTTCTTCGATTGAACACCAG AGG (reversed) Intergenic