ID: 967970240

View in Genome Browser
Species Human (GRCh38)
Location 3:194994148-194994170
Sequence GGGGCAGCTGGGAGGCAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967970240_967970248 0 Left 967970240 3:194994148-194994170 CCTCGCTGCCTCCCAGCTGCCCC No data
Right 967970248 3:194994171-194994193 CGTCGCCCCACACTTACCCTCGG No data
967970240_967970249 1 Left 967970240 3:194994148-194994170 CCTCGCTGCCTCCCAGCTGCCCC No data
Right 967970249 3:194994172-194994194 GTCGCCCCACACTTACCCTCGGG No data
967970240_967970250 2 Left 967970240 3:194994148-194994170 CCTCGCTGCCTCCCAGCTGCCCC No data
Right 967970250 3:194994173-194994195 TCGCCCCACACTTACCCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967970240 Original CRISPR GGGGCAGCTGGGAGGCAGCG AGG (reversed) Intergenic
No off target data available for this crispr