ID: 967971824

View in Genome Browser
Species Human (GRCh38)
Location 3:195004952-195004974
Sequence CGCAGCTAAACAGTACAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967971824_967971830 17 Left 967971824 3:195004952-195004974 CCTCCTTGTACTGTTTAGCTGCG No data
Right 967971830 3:195004992-195005014 GGGCCACCCACCCACAGTGCAGG No data
967971824_967971827 -4 Left 967971824 3:195004952-195004974 CCTCCTTGTACTGTTTAGCTGCG No data
Right 967971827 3:195004971-195004993 TGCGTCCAGGATTCTGCAGTCGG No data
967971824_967971832 20 Left 967971824 3:195004952-195004974 CCTCCTTGTACTGTTTAGCTGCG No data
Right 967971832 3:195004995-195005017 CCACCCACCCACAGTGCAGGTGG No data
967971824_967971828 -3 Left 967971824 3:195004952-195004974 CCTCCTTGTACTGTTTAGCTGCG No data
Right 967971828 3:195004972-195004994 GCGTCCAGGATTCTGCAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967971824 Original CRISPR CGCAGCTAAACAGTACAAGG AGG (reversed) Intergenic
No off target data available for this crispr