ID: 967971825

View in Genome Browser
Species Human (GRCh38)
Location 3:195004955-195004977
Sequence GGACGCAGCTAAACAGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967971825_967971827 -7 Left 967971825 3:195004955-195004977 CCTTGTACTGTTTAGCTGCGTCC No data
Right 967971827 3:195004971-195004993 TGCGTCCAGGATTCTGCAGTCGG No data
967971825_967971832 17 Left 967971825 3:195004955-195004977 CCTTGTACTGTTTAGCTGCGTCC No data
Right 967971832 3:195004995-195005017 CCACCCACCCACAGTGCAGGTGG No data
967971825_967971828 -6 Left 967971825 3:195004955-195004977 CCTTGTACTGTTTAGCTGCGTCC No data
Right 967971828 3:195004972-195004994 GCGTCCAGGATTCTGCAGTCGGG No data
967971825_967971830 14 Left 967971825 3:195004955-195004977 CCTTGTACTGTTTAGCTGCGTCC No data
Right 967971830 3:195004992-195005014 GGGCCACCCACCCACAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967971825 Original CRISPR GGACGCAGCTAAACAGTACA AGG (reversed) Intergenic
No off target data available for this crispr