ID: 967971829

View in Genome Browser
Species Human (GRCh38)
Location 3:195004976-195004998
Sequence GTGGCCCGACTGCAGAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967971829_967971830 -7 Left 967971829 3:195004976-195004998 CCAGGATTCTGCAGTCGGGCCAC No data
Right 967971830 3:195004992-195005014 GGGCCACCCACCCACAGTGCAGG No data
967971829_967971832 -4 Left 967971829 3:195004976-195004998 CCAGGATTCTGCAGTCGGGCCAC No data
Right 967971832 3:195004995-195005017 CCACCCACCCACAGTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967971829 Original CRISPR GTGGCCCGACTGCAGAATCC TGG (reversed) Intergenic
No off target data available for this crispr