ID: 967971830

View in Genome Browser
Species Human (GRCh38)
Location 3:195004992-195005014
Sequence GGGCCACCCACCCACAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967971829_967971830 -7 Left 967971829 3:195004976-195004998 CCAGGATTCTGCAGTCGGGCCAC No data
Right 967971830 3:195004992-195005014 GGGCCACCCACCCACAGTGCAGG No data
967971825_967971830 14 Left 967971825 3:195004955-195004977 CCTTGTACTGTTTAGCTGCGTCC No data
Right 967971830 3:195004992-195005014 GGGCCACCCACCCACAGTGCAGG No data
967971824_967971830 17 Left 967971824 3:195004952-195004974 CCTCCTTGTACTGTTTAGCTGCG No data
Right 967971830 3:195004992-195005014 GGGCCACCCACCCACAGTGCAGG No data
967971823_967971830 25 Left 967971823 3:195004944-195004966 CCTGGCGGCCTCCTTGTACTGTT No data
Right 967971830 3:195004992-195005014 GGGCCACCCACCCACAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967971830 Original CRISPR GGGCCACCCACCCACAGTGC AGG Intergenic
No off target data available for this crispr