ID: 967973142

View in Genome Browser
Species Human (GRCh38)
Location 3:195013939-195013961
Sequence TTAGGAGGCTCCATTTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967973142_967973153 3 Left 967973142 3:195013939-195013961 CCTTGCCAAATGGAGCCTCCTAA No data
Right 967973153 3:195013965-195013987 CTCAGCATCTTTAGGAGGGGGGG No data
967973142_967973149 0 Left 967973142 3:195013939-195013961 CCTTGCCAAATGGAGCCTCCTAA No data
Right 967973149 3:195013962-195013984 AGCCTCAGCATCTTTAGGAGGGG No data
967973142_967973152 2 Left 967973142 3:195013939-195013961 CCTTGCCAAATGGAGCCTCCTAA No data
Right 967973152 3:195013964-195013986 CCTCAGCATCTTTAGGAGGGGGG No data
967973142_967973148 -1 Left 967973142 3:195013939-195013961 CCTTGCCAAATGGAGCCTCCTAA No data
Right 967973148 3:195013961-195013983 AAGCCTCAGCATCTTTAGGAGGG No data
967973142_967973147 -2 Left 967973142 3:195013939-195013961 CCTTGCCAAATGGAGCCTCCTAA No data
Right 967973147 3:195013960-195013982 AAAGCCTCAGCATCTTTAGGAGG No data
967973142_967973150 1 Left 967973142 3:195013939-195013961 CCTTGCCAAATGGAGCCTCCTAA No data
Right 967973150 3:195013963-195013985 GCCTCAGCATCTTTAGGAGGGGG No data
967973142_967973146 -5 Left 967973142 3:195013939-195013961 CCTTGCCAAATGGAGCCTCCTAA No data
Right 967973146 3:195013957-195013979 CCTAAAGCCTCAGCATCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967973142 Original CRISPR TTAGGAGGCTCCATTTGGCA AGG (reversed) Intergenic
No off target data available for this crispr