ID: 967973147

View in Genome Browser
Species Human (GRCh38)
Location 3:195013960-195013982
Sequence AAAGCCTCAGCATCTTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967973143_967973147 -7 Left 967973143 3:195013944-195013966 CCAAATGGAGCCTCCTAAAGCCT No data
Right 967973147 3:195013960-195013982 AAAGCCTCAGCATCTTTAGGAGG No data
967973142_967973147 -2 Left 967973142 3:195013939-195013961 CCTTGCCAAATGGAGCCTCCTAA No data
Right 967973147 3:195013960-195013982 AAAGCCTCAGCATCTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967973147 Original CRISPR AAAGCCTCAGCATCTTTAGG AGG Intergenic
No off target data available for this crispr