ID: 967975747

View in Genome Browser
Species Human (GRCh38)
Location 3:195033975-195033997
Sequence CACCCGCGGCTTCCCACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967975737_967975747 29 Left 967975737 3:195033923-195033945 CCTTTCTAATTTAAAAGGACAAG No data
Right 967975747 3:195033975-195033997 CACCCGCGGCTTCCCACTTCAGG No data
967975745_967975747 -10 Left 967975745 3:195033962-195033984 CCTTTCCGTTTCACACCCGCGGC No data
Right 967975747 3:195033975-195033997 CACCCGCGGCTTCCCACTTCAGG No data
967975743_967975747 4 Left 967975743 3:195033948-195033970 CCAGGGGCTGGATGCCTTTCCGT No data
Right 967975747 3:195033975-195033997 CACCCGCGGCTTCCCACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967975747 Original CRISPR CACCCGCGGCTTCCCACTTC AGG Intergenic
No off target data available for this crispr