ID: 967981776

View in Genome Browser
Species Human (GRCh38)
Location 3:195070068-195070090
Sequence CCCGGGTCTGGGGGTTCTCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 170}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967981760_967981776 7 Left 967981760 3:195070038-195070060 CCGGCAGCCCCTCGGGGGGCGGG 0: 1
1: 0
2: 3
3: 27
4: 308
Right 967981776 3:195070068-195070090 CCCGGGTCTGGGGGTTCTCATGG 0: 1
1: 0
2: 1
3: 12
4: 170
967981750_967981776 22 Left 967981750 3:195070023-195070045 CCCCGCTGTTGAAGCCCGGCAGC 0: 1
1: 0
2: 1
3: 2
4: 56
Right 967981776 3:195070068-195070090 CCCGGGTCTGGGGGTTCTCATGG 0: 1
1: 0
2: 1
3: 12
4: 170
967981762_967981776 0 Left 967981762 3:195070045-195070067 CCCCTCGGGGGGCGGGCCCCCAA 0: 1
1: 0
2: 0
3: 2
4: 83
Right 967981776 3:195070068-195070090 CCCGGGTCTGGGGGTTCTCATGG 0: 1
1: 0
2: 1
3: 12
4: 170
967981758_967981776 8 Left 967981758 3:195070037-195070059 CCCGGCAGCCCCTCGGGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 307
Right 967981776 3:195070068-195070090 CCCGGGTCTGGGGGTTCTCATGG 0: 1
1: 0
2: 1
3: 12
4: 170
967981763_967981776 -1 Left 967981763 3:195070046-195070068 CCCTCGGGGGGCGGGCCCCCAAC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 967981776 3:195070068-195070090 CCCGGGTCTGGGGGTTCTCATGG 0: 1
1: 0
2: 1
3: 12
4: 170
967981764_967981776 -2 Left 967981764 3:195070047-195070069 CCTCGGGGGGCGGGCCCCCAACC 0: 1
1: 0
2: 1
3: 8
4: 150
Right 967981776 3:195070068-195070090 CCCGGGTCTGGGGGTTCTCATGG 0: 1
1: 0
2: 1
3: 12
4: 170
967981752_967981776 20 Left 967981752 3:195070025-195070047 CCGCTGTTGAAGCCCGGCAGCCC 0: 1
1: 0
2: 0
3: 11
4: 125
Right 967981776 3:195070068-195070090 CCCGGGTCTGGGGGTTCTCATGG 0: 1
1: 0
2: 1
3: 12
4: 170
967981751_967981776 21 Left 967981751 3:195070024-195070046 CCCGCTGTTGAAGCCCGGCAGCC 0: 1
1: 0
2: 0
3: 16
4: 109
Right 967981776 3:195070068-195070090 CCCGGGTCTGGGGGTTCTCATGG 0: 1
1: 0
2: 1
3: 12
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967981776 Original CRISPR CCCGGGTCTGGGGGTTCTCA TGG Exonic