ID: 967982391

View in Genome Browser
Species Human (GRCh38)
Location 3:195073478-195073500
Sequence TTGTGGGCATGAGGGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 578}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967982391_967982403 4 Left 967982391 3:195073478-195073500 CCCTCCCCCCCTCATGCCCACAA 0: 1
1: 0
2: 3
3: 37
4: 578
Right 967982403 3:195073505-195073527 GCCACTTTGCTCTAACTATCTGG 0: 1
1: 0
2: 0
3: 5
4: 66
967982391_967982405 21 Left 967982391 3:195073478-195073500 CCCTCCCCCCCTCATGCCCACAA 0: 1
1: 0
2: 3
3: 37
4: 578
Right 967982405 3:195073522-195073544 ATCTGGATTGTCTAACCGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 31
967982391_967982406 28 Left 967982391 3:195073478-195073500 CCCTCCCCCCCTCATGCCCACAA 0: 1
1: 0
2: 3
3: 37
4: 578
Right 967982406 3:195073529-195073551 TTGTCTAACCGTCCGGCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967982391 Original CRISPR TTGTGGGCATGAGGGGGGGA GGG (reversed) Intronic
900662213 1:3790451-3790473 GTGTGGGAATGAGGGATGGATGG - Intronic
900935621 1:5764691-5764713 GTGAGGGCATGAGGGGGTTAGGG - Intergenic
900983037 1:6057439-6057461 CTGAGGGCAGGAGGAGGGGAAGG + Intronic
901024804 1:6273539-6273561 GTGGGGGCAGGAGGGGGGCAGGG + Intronic
901473182 1:9471903-9471925 TGGTGGGGATGAGGGCGGGGTGG - Intergenic
902409249 1:16203169-16203191 TTGTAGGCAGGATGGGTGGAGGG + Intronic
902839856 1:19067865-19067887 TTGTGGACAGAAGGGGTGGATGG + Intergenic
903249642 1:22043451-22043473 ATGTGGGCATAAGTGGAGGAGGG + Intergenic
903507911 1:23851852-23851874 TTGTTGGAATGTGGGGGTGAGGG + Intronic
903557383 1:24203482-24203504 TCGTAGGCAGGAGGGAGGGAAGG - Intergenic
904267896 1:29328338-29328360 ATGTTGGCACGAGGGAGGGAAGG + Intergenic
904661486 1:32088811-32088833 TTGTGGTAATGAGGGGGCGGGGG - Intronic
904827629 1:33284610-33284632 TTCTGGGGGTGAGGGTGGGAGGG - Intronic
904998910 1:34652806-34652828 TTGTGGGGATGAGGGCCTGAGGG - Intergenic
905582284 1:39091230-39091252 ATGTGTGAATGAGTGGGGGAGGG - Intronic
905777611 1:40679291-40679313 TTGTGTGCCTGGGGAGGGGATGG - Intergenic
905999991 1:42416407-42416429 TGGTGGGCAGGAGGAGGGGTTGG - Exonic
906118917 1:43374520-43374542 TTGTGGTGATGTGGGGGGCAAGG + Intergenic
906210571 1:44010449-44010471 TTGTGGGCGGGGGGGGGGGGGGG + Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906454583 1:45982769-45982791 TTGTGGGGATGGCAGGGGGAGGG - Intronic
906593065 1:47046444-47046466 CTGTGAGGATGAGGGAGGGAAGG - Intronic
907142144 1:52197227-52197249 TTGTGAGCATTATGGGGAGAGGG + Intronic
907189114 1:52633788-52633810 CTGTGGGCATGAGGACGGTAAGG - Intronic
907392470 1:54167209-54167231 ATGTGGTCATGGGGTGGGGAGGG + Intronic
907933950 1:59025512-59025534 TGGTGGGCGTGGGGAGGGGAAGG - Intergenic
907935884 1:59041926-59041948 TTGTGGGGAAGAGGGGGAGGTGG + Intergenic
909517922 1:76533317-76533339 TTGTGGGAATGAGGAGCAGATGG - Intronic
910269418 1:85377697-85377719 GTGGGGGGATGAGGGGGAGAAGG - Intronic
910934486 1:92476208-92476230 CTGTGGGGATGGGAGGGGGAGGG + Intronic
911815992 1:102351860-102351882 TTGTGGGCTGGAGGGGGGAGTGG + Intergenic
913432063 1:118806102-118806124 TTGAGGGAAAGAGGGAGGGAGGG + Intergenic
915311439 1:155007687-155007709 CTGTGGGCCTGAGGTGGGGGAGG - Intronic
915987643 1:160482261-160482283 GTGTTGGCTTGAGGGTGGGATGG + Intergenic
915993025 1:160536219-160536241 CTGTTGGGATGAGGAGGGGATGG + Intergenic
916030326 1:160871358-160871380 TGGTGGGCATGGGGTGCGGAGGG - Intergenic
916311892 1:163407106-163407128 TTGGGGGCAGAAGAGGGGGAAGG + Intergenic
916553595 1:165873826-165873848 TTTTAGGCAGGAGGGAGGGAGGG - Intronic
916669497 1:167001253-167001275 TTGGGGGCAGAAGGGTGGGAAGG + Intronic
917911232 1:179648444-179648466 TTGTGGGGTGGGGGGGGGGAGGG + Intronic
918080919 1:181207100-181207122 CTGTGGCCACGAGGGAGGGAGGG - Intergenic
918322812 1:183381066-183381088 TTGTGAGAATGAGGGAGAGATGG + Intronic
918406215 1:184214043-184214065 CTCTGGGCCTGAGGAGGGGAGGG - Intergenic
918989893 1:191684938-191684960 CTGTGGGCCTGTGGGGGTGATGG - Intergenic
920269829 1:204754668-204754690 TTGTGGGGATGGGGGTGGGGGGG - Intergenic
920359163 1:205400840-205400862 TTGTGGGGTGGGGGGGGGGAGGG - Intronic
920412607 1:205774295-205774317 TTGTGGGGCTGTGGGTGGGATGG - Intronic
921479281 1:215645184-215645206 TTGTGGGCATGAAGGGAGAAAGG + Intronic
923328226 1:232899198-232899220 TTGTGGGCAAAAGGGAGAGAAGG + Intergenic
923362653 1:233226800-233226822 GTGTGGGCATGGGGAGAGGAGGG - Intronic
923835580 1:237607421-237607443 TTGTGGGGTTGGGGGAGGGAGGG + Intronic
1062814949 10:492384-492406 TTGTGAGAATGAGGGGGTGATGG - Intronic
1062822977 10:548497-548519 ATGTGGCCAGGAGGGAGGGAGGG + Intronic
1062833790 10:623448-623470 CTGTGGGGCTGAGGGGAGGAGGG + Intronic
1062838329 10:650724-650746 AAGTGAGCATGAGGGGGGGTCGG - Intronic
1063775697 10:9261227-9261249 ATGTGGGCATGAAGTGAGGAGGG - Intergenic
1064631320 10:17315724-17315746 TTCTGGGGACGAGGGTGGGATGG + Intergenic
1064778876 10:18810846-18810868 TTGTGTCCATGAGAGGGAGAGGG - Intergenic
1065980966 10:30896652-30896674 TTGTGGGGAGGAGGGGAGGCCGG + Intronic
1067003855 10:42642569-42642591 TTATGGGCATTAGAGGGTGAGGG - Intergenic
1067088254 10:43254031-43254053 CTGTGGGCCTGAGGGTGGGGAGG - Intronic
1067152728 10:43749756-43749778 GTGTGGGAATGAGGATGGGAGGG + Intergenic
1067504305 10:46837060-46837082 TTATTGGCATGAGGGGAGGGGGG - Intergenic
1068045505 10:51881160-51881182 TAGTGCGCATGAAGGGGAGAGGG + Intronic
1068192297 10:53667591-53667613 ATTTGGGCATGAGGTGGAGAAGG - Intergenic
1068295502 10:55067220-55067242 TTGTGGGGATGAAGGGAGGTTGG - Intronic
1070553831 10:77513138-77513160 TTTAGGGCATGAGGTGGTGATGG - Intronic
1071065513 10:81630013-81630035 TTCTGGGCAGGAGAGTGGGAAGG - Intergenic
1071100463 10:82030730-82030752 TTGGGGGAATGAGGGCAGGAAGG + Intronic
1071576320 10:86729441-86729463 GTGTGGGTATCAGGAGGGGATGG + Intronic
1071607711 10:87008970-87008992 TTATTGGCATGAGGGGAGGGGGG - Intergenic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072190687 10:93074261-93074283 AAGTGGGCATGAGGGGGCGCCGG - Intronic
1072356230 10:94614305-94614327 TTGAGGGCTGGAGGGGGTGATGG - Intergenic
1072628322 10:97128556-97128578 TTGTGGGCATCAGGGCAGGAGGG - Intronic
1072827133 10:98618587-98618609 TGGGGGGCATGGGGGAGGGACGG + Intronic
1073299717 10:102463492-102463514 CTGTGGGCTGGAGGAGGGGAAGG + Intronic
1073323161 10:102627925-102627947 CTGCGGGCAGGAGCGGGGGAGGG - Intronic
1073558569 10:104477857-104477879 ATGTGGGCATGTGGGAAGGATGG + Intergenic
1073649753 10:105345582-105345604 AAGGGGGCATGAGGGAGGGATGG - Intergenic
1073869167 10:107842416-107842438 TTCTGGGCAAGAGGGTGGCAGGG - Intergenic
1073989175 10:109243626-109243648 TTGTAGGCCTGAAGCGGGGAAGG - Intergenic
1075093895 10:119458693-119458715 TTGCGGGCCTCAGGGAGGGAAGG - Intronic
1075498793 10:122953794-122953816 TCCTGGGCGTGAGAGGGGGAAGG - Intronic
1075555206 10:123425846-123425868 TTGCGGGCATATGGGAGGGAAGG + Intergenic
1075956048 10:126524235-126524257 ATGTGGTCATGAAGGGAGGAAGG - Intronic
1076050906 10:127332496-127332518 TTGTGGGCAACAGGGGTGGAGGG - Intronic
1076602720 10:131669464-131669486 CTGTGTGCATGAGGGAGGCAAGG + Intergenic
1077190770 11:1255215-1255237 TGGTGGGCATGGGGTGGGGGTGG - Exonic
1077220347 11:1412958-1412980 CTGTAGGCCTGAGGGGTGGATGG + Intronic
1077236778 11:1485702-1485724 GTGTGGGCATGAGGGGCCGGGGG - Intronic
1077333971 11:1995126-1995148 CTGTGGGCATGATGTGGGGGAGG - Intergenic
1077360553 11:2138692-2138714 GGGCGGGCGTGAGGGGGGGAGGG + Intronic
1077374520 11:2199300-2199322 TTCTGGGCAGGAGGGTGAGAAGG - Intergenic
1077411562 11:2406209-2406231 ATCTGGGCATGAGGGAGGAAGGG - Intronic
1077475437 11:2788147-2788169 TTGGGGGCATGGGGTGGAGAGGG - Intronic
1077895103 11:6448334-6448356 TTGTGGGGTTGGGGGGGTGAGGG - Intergenic
1078918550 11:15804562-15804584 TTGTGGCCATCAGGAGGGGCTGG - Intergenic
1079562440 11:21839134-21839156 TTGTGGGGTGGGGGGGGGGAGGG + Intergenic
1079807898 11:24957895-24957917 TTGTGGGGTTGGGGAGGGGAGGG - Intronic
1080084714 11:28265953-28265975 TTGTGGGCTGGTGGGGGGAAGGG - Intronic
1080824081 11:35833258-35833280 TGGTGTGGATGAGGGAGGGAAGG - Intergenic
1081243027 11:40730102-40730124 TTGTGGGGTTGGGGGGGGCAGGG + Intronic
1082734333 11:56839268-56839290 TTGGGGGCATGGGGAGGGGCGGG - Intergenic
1082739488 11:56894858-56894880 TTGTGAGGATGAAGGTGGGAGGG - Intergenic
1082762936 11:57144552-57144574 ATGTGGGCATTAAAGGGGGAAGG - Intergenic
1083034960 11:59628521-59628543 GGGTGGGCAGGAGGGAGGGAGGG - Intergenic
1083267877 11:61555307-61555329 TTGGGGGCAGCAGGGGGCGAGGG - Intronic
1084006140 11:66324685-66324707 GTGTGGGCCTGTGGGGGTGAGGG + Intergenic
1084501128 11:69536091-69536113 TGATGGGCATGAGGGGAGGGAGG - Intergenic
1084593955 11:70106164-70106186 GTGTGGGCAGGAGGGAGGGTTGG + Intronic
1084931768 11:72561818-72561840 GTGTGGGCAGGAGGGAGGGAGGG - Intergenic
1084980240 11:72825017-72825039 ATGTGGGCATAAGCCGGGGAGGG + Intronic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085074455 11:73577855-73577877 CACTGGGCATGAGGGAGGGAAGG + Intronic
1085597047 11:77820258-77820280 GTGTGGGCTGGAGGCGGGGAGGG - Intronic
1086231163 11:84571543-84571565 TGGTGAGCAGGAGGAGGGGAGGG - Intronic
1086420653 11:86634098-86634120 TTTTGGGCATGAGGAAGGGAAGG + Intronic
1086425200 11:86676222-86676244 TTGTGGGCATCAGGGAGGGAGGG - Intergenic
1086890496 11:92252918-92252940 TAGAGGGCAGGAGGGGAGGATGG - Intergenic
1087714915 11:101596589-101596611 TAGTGGGCATGGAGGGGGGATGG + Intronic
1088100441 11:106148663-106148685 CTGGGGGCATGCGTGGGGGATGG - Intergenic
1088334855 11:108692498-108692520 TTGTGGGAATGGGACGGGGATGG + Intronic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089460092 11:118647920-118647942 TTGGGGGCAGGAGCGGGAGATGG + Exonic
1089661168 11:119986467-119986489 TGGTGGGCAAGAGGAGGGGTTGG + Intergenic
1089677836 11:120102202-120102224 CTGTGTGTATGAGTGGGGGATGG - Intergenic
1090098159 11:123764476-123764498 ATCTGGGCAGGAGGAGGGGAAGG + Intergenic
1090556135 11:127878538-127878560 TGGTGGGCCTGAGGAGGGCATGG - Intergenic
1202816954 11_KI270721v1_random:50308-50330 CTGTGGGCATGATGTGGGGGAGG - Intergenic
1092016913 12:5167231-5167253 CTGTGGGCAAGGGTGGGGGATGG + Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092233606 12:6791970-6791992 TTGAGGGGATGAGGGAAGGAGGG + Intronic
1092997921 12:13967816-13967838 TTGCAGGCATGAGGGGAGGTGGG + Intronic
1094207178 12:27852972-27852994 TTGTGGGAGTGTGGGGGAGAAGG - Intergenic
1094365985 12:29681660-29681682 TTGTGGGGGTGGGAGGGGGAGGG - Intronic
1094871319 12:34600726-34600748 CTGTGGGCATGAAGCTGGGACGG - Intergenic
1096403980 12:51329479-51329501 CTGTGGGTATGTGGAGGGGAGGG + Intronic
1096543750 12:52323009-52323031 CTGTGGGCCTGAGGGAGGGCAGG + Intergenic
1096597024 12:52702326-52702348 TTGTGGGCTAGATGGGTGGATGG + Intronic
1096816941 12:54207804-54207826 GTGTGAGGATGAGGTGGGGAAGG - Intergenic
1097145388 12:56936191-56936213 CTGTGTGCATGGGGTGGGGATGG - Intergenic
1097677487 12:62618682-62618704 TTCTGTGCATGAGGGGGCAAAGG + Intergenic
1098065262 12:66608005-66608027 ATGTGGGCAGCAGGTGGGGAGGG + Intronic
1098381911 12:69878895-69878917 TGCTGGGCATGGGGGGGTGAGGG - Intronic
1098807487 12:75037783-75037805 ATGTGGGGATGTGGGGGGGTGGG + Intergenic
1100080261 12:90840704-90840726 TTGGGGGCTTGAGAGGGGCAGGG + Intergenic
1100227353 12:92572665-92572687 ATTTGGGCATGAAGGTGGGAAGG + Intergenic
1100588269 12:95999549-95999571 TTGTTGGCATGGGGTGGGGGTGG - Intergenic
1100875219 12:98954918-98954940 GGGTGGGCAGGAGGGAGGGAGGG - Intronic
1101065439 12:101015833-101015855 TTGTGTGCATGAGGGGATGGGGG + Intronic
1101425082 12:104581606-104581628 TGGTGGGCAGGAGGGTGGGGAGG + Intronic
1101891044 12:108715641-108715663 TTGTGAGTATGCGGGGGGGAGGG - Intronic
1102442555 12:112974863-112974885 TTGTGGGCAGGAGAGGAGGTGGG - Intergenic
1102445509 12:112999237-112999259 TTTTGGGGATGGGAGGGGGAAGG - Intronic
1102770634 12:115473070-115473092 TTGTGGGCATGGGTGGGGTTAGG - Intergenic
1102952942 12:117042202-117042224 TCATGGGCTTGAGGGTGGGATGG + Intronic
1104251071 12:127094744-127094766 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
1104356279 12:128089795-128089817 ATGTGGGCATGGTGGAGGGAGGG + Intergenic
1106516257 13:30456753-30456775 TTGTGGGCGGGGGGGGGGGGTGG + Exonic
1108268869 13:48738997-48739019 ATGTGGGCCTGAGGGAGAGAGGG - Intergenic
1108307353 13:49151712-49151734 TTGGGGGGATGGGGGAGGGATGG - Intronic
1108945162 13:56013695-56013717 TTGTGTGCATAAGTGTGGGAGGG + Intergenic
1109737709 13:66508241-66508263 TTGTGGGGATTAGGGGAGGAGGG + Intronic
1111198154 13:84899546-84899568 ATATGGACATGAGGGGAGGATGG + Intergenic
1112437275 13:99399459-99399481 TGGTGGGCATGGGTGGGGGACGG - Intergenic
1113425743 13:110207097-110207119 TGGGGGGCAGGAGGGGGGCAGGG - Intronic
1113932915 13:113977718-113977740 ATGTGGGCATTAGGGGTGGGGGG - Intergenic
1114470771 14:22959606-22959628 TTTGGGGAATGAGGGGGTGAAGG + Intronic
1114502509 14:23181443-23181465 TGGTGGGGGTGGGGGGGGGATGG + Intronic
1114683123 14:24503728-24503750 TTGTGGGGTTGGGGGGGGGTAGG + Intronic
1115545683 14:34462879-34462901 GTGTGTGCATGGGTGGGGGAAGG - Intergenic
1115771570 14:36667280-36667302 TTGGAGACATGAGGGAGGGACGG - Intronic
1117069945 14:52047404-52047426 GTGTGGGCATGTGGGAGGGATGG + Intronic
1118169454 14:63372647-63372669 TTGTGGGGATGAGGGTGGGATGG - Exonic
1118785744 14:69044130-69044152 TAGTTGGCCTGAGGGGAGGAGGG + Intergenic
1118879025 14:69810609-69810631 TTGTGGGCTTGGGGTGGGGAAGG - Intergenic
1120762577 14:88298836-88298858 TTGGGGGCATGAAGGTGGAAAGG - Intronic
1121210257 14:92203073-92203095 ATGGGTGCATGAGGGAGGGAAGG + Intergenic
1121274969 14:92661292-92661314 TTGTGGGTATGATTGGGGTATGG + Intronic
1121605459 14:95236875-95236897 TTGTGGGAATGGTGTGGGGAGGG + Intronic
1121990424 14:98551794-98551816 TTGTAGGCATGGGGTGGGCATGG - Intergenic
1122209927 14:100167382-100167404 TTGGGGGCCTGTGGGGGGGCGGG - Intergenic
1123038330 14:105480317-105480339 TTCTGAGCAGGAGGGAGGGATGG + Intergenic
1123212157 14:106771400-106771422 TGGTGGGCATCTGGGGGGCAAGG + Intergenic
1202918960 14_KI270723v1_random:13206-13228 TTGTGGGCATGACTGAGGCAGGG + Intergenic
1202925669 14_KI270724v1_random:21786-21808 TTGTGGGCATGACCGAGGCAGGG - Intergenic
1123992497 15:25694026-25694048 TTGTTGGCATGTGGGGGTCACGG + Intronic
1124632499 15:31345570-31345592 CTGTGAGTATGAGGGTGGGACGG + Intronic
1124861589 15:33447432-33447454 AAGTGGGCATGGGGTGGGGAAGG - Intronic
1125944833 15:43704409-43704431 TTGGGAGCAGGAGGGAGGGAAGG - Intergenic
1126161581 15:45618971-45618993 CTGTGGGCATGATGGGGGCCAGG + Intronic
1126721255 15:51582893-51582915 TCCTGGGAATGAGGAGGGGAGGG - Intronic
1127496167 15:59514070-59514092 TTGGGGGCATGGGGGGGGCAAGG + Intronic
1128094644 15:64944489-64944511 TTCTGGGCATGAAGGGGATATGG - Intronic
1128331147 15:66756612-66756634 TTGTGGGTATGTGGGATGGAGGG - Intronic
1128370397 15:67035568-67035590 TCATGGGCATGGGGTGGGGATGG + Intergenic
1128508973 15:68302027-68302049 TGGCGGGCATGAGGGAAGGATGG + Exonic
1128546016 15:68568263-68568285 TTGTGGGGATGGGGGTGGGGTGG - Intergenic
1128697927 15:69782225-69782247 CTGTGGACATGAGAGGGAGATGG + Intergenic
1129935103 15:79440655-79440677 TGGTGGGGAGGAGCGGGGGAAGG - Intronic
1130161715 15:81407942-81407964 TTGCGGGCAGGAGCTGGGGAGGG + Intergenic
1130172303 15:81527972-81527994 TTGTGGGGAGCAGGGGTGGAGGG + Intergenic
1132087858 15:98922733-98922755 TTGTGCGCAAGAGGGGGCAAAGG - Intronic
1132120006 15:99168373-99168395 TTGTGGTCATGGAGGGGGGCTGG - Intronic
1132142479 15:99407175-99407197 TGATGGGCACGAGGTGGGGACGG - Intergenic
1132499583 16:279579-279601 TTGTGGGCAGTTGGGGGGCAAGG + Intronic
1132752741 16:1466286-1466308 ATGGGGGGATGAGGAGGGGACGG - Intronic
1133303657 16:4797400-4797422 TGGTGGGTATGAGTAGGGGACGG + Exonic
1134063011 16:11210394-11210416 TTGTGGGCACGAGGGGAGGAAGG - Intergenic
1134428086 16:14172216-14172238 TTGTGGGGGGGAGGCGGGGAAGG - Intronic
1134448133 16:14346084-14346106 GTGTGGGGATGAGGGAGGGCAGG - Intergenic
1134504406 16:14793297-14793319 TTGTGGGCTTGGGGTTGGGAGGG - Intronic
1134576167 16:15335612-15335634 TTGTGGGCTTGGGGTTGGGAGGG + Intergenic
1134726276 16:16420890-16420912 TTGTGGGCTTGGGGTTGGGAGGG - Intergenic
1134941156 16:18290970-18290992 TTGTGGGCTTGGGGTTGGGAGGG + Intergenic
1135304193 16:21354724-21354746 CTGTGGGCATGGGGGTGGGGAGG - Intergenic
1135390035 16:22084759-22084781 TTGTTGGCATTGGGGGGTGAGGG + Intronic
1136066124 16:27760082-27760104 TTGTGGCCATGAAGAGGGGCTGG - Intronic
1136300934 16:29333861-29333883 CTGTGGGCATGGGGGTGGGGAGG - Intergenic
1137282105 16:46986108-46986130 TTGGGGGAATGGGGCGGGGATGG + Intergenic
1137803531 16:51283179-51283201 CTGAGGGCAGGAGGAGGGGAAGG - Intergenic
1138248919 16:55487699-55487721 TTGGGTGGATGAGGGGAGGATGG + Intronic
1138791226 16:59906354-59906376 TAGTGGGCATGAGGAAAGGAAGG - Intergenic
1141376849 16:83539176-83539198 CTGTGGGCAAGGGTGGGGGATGG + Intronic
1142062634 16:88040590-88040612 CTGTGGGCATGGGGGTGGGGAGG - Intronic
1142137696 16:88459208-88459230 TTGTGGGCCTGAGCGGGGAGTGG - Intronic
1142285365 16:89169473-89169495 TCATGGGCATGAGGTGGGGGTGG - Intergenic
1142312825 16:89323785-89323807 GTGTGGCCCTGAGGAGGGGAAGG - Intronic
1142500919 17:332490-332512 GTGTGGGCATCAGGAAGGGAGGG - Intronic
1142515072 17:422477-422499 TTGTGGCCAGAAGGGGAGGAGGG + Intronic
1142567712 17:851375-851397 TAGAAGGCATGAGCGGGGGACGG + Intronic
1143235007 17:5392194-5392216 TTGTAGGCATGCAGGTGGGATGG - Intronic
1143922417 17:10340858-10340880 TTGTGGGAATGGGGTGGGAATGG + Intronic
1144085777 17:11807354-11807376 TTTTGGGCAAGAAGAGGGGACGG - Intronic
1145410004 17:22650899-22650921 TTGTGGGGTCGGGGGGGGGAGGG + Intergenic
1147316176 17:39621498-39621520 TTGTGGGACTTAGGGAGGGATGG + Intergenic
1147393499 17:40123421-40123443 TTGTGCGCATGCTCGGGGGAAGG + Intronic
1147402426 17:40188983-40189005 GTGTGGGCATTAGGAGGGGCAGG + Intronic
1148431771 17:47649333-47649355 TCGCGGGCCTGAGCGGGGGAGGG - Intergenic
1148559318 17:48596991-48597013 TTGGGGGGATGACGGGGGGTGGG - Intronic
1150618225 17:66788871-66788893 CTGTGGGCCTGAGGGGGAGAGGG + Exonic
1151399101 17:73843932-73843954 TTGGGGGCATGAGGGGAGTGGGG - Intergenic
1151677176 17:75604544-75604566 TTGTGGGAGGGAGGGAGGGAGGG - Intergenic
1152467331 17:80473755-80473777 TGGTGGGCATGAGAAGGGAATGG + Intronic
1152477267 17:80526450-80526472 ACCTGGGCATGAGGGGGGAAGGG - Intergenic
1152556425 17:81055356-81055378 TTGTGGGCATGAATGGGACAGGG + Intronic
1152621251 17:81366022-81366044 CTGTGGCCATGAAGGCGGGAGGG - Intergenic
1152722896 17:81931568-81931590 ATGTGGGCATCAGGGCGGGTGGG - Intergenic
1154096529 18:11421546-11421568 GTGGGGGGATGAGGGGAGGAGGG - Intergenic
1154271692 18:12925842-12925864 TTGGGAGGCTGAGGGGGGGACGG + Intronic
1154342461 18:13515276-13515298 CTGTAGGCATGAGGGAAGGAAGG + Intronic
1155264472 18:24077564-24077586 TTGTGGGCATTAGGCGGGATTGG + Intronic
1155878863 18:31119112-31119134 AGGTGGGCATGAGGGAAGGAAGG + Intergenic
1157267046 18:46234631-46234653 GTGTGGGCATGAGGGACTGAGGG - Intronic
1157582553 18:48782044-48782066 TGGTGGGCAGGAGGGTGGGGTGG + Intronic
1157752811 18:50194271-50194293 TTGTGGGTATGCGGGAGGAAAGG + Intronic
1158243691 18:55406733-55406755 TTGTGGGGATGGGGGGAGGCGGG - Intronic
1160966932 19:1750782-1750804 TTGTGGGCAGGGGGAGGGGTGGG - Intergenic
1161507010 19:4649536-4649558 TTGAGGGCGTTAGGTGGGGAAGG + Intronic
1162188224 19:8923543-8923565 TTTTGGGCTTGAGTGGGGAAGGG - Intronic
1162671400 19:12260581-12260603 TTGCGGGCATGAGGGGCTGGTGG - Intronic
1163472474 19:17505545-17505567 TTCAGGGCATCAGGAGGGGAAGG - Exonic
1164308918 19:24029617-24029639 TTCTGGGCCTGAGGGCAGGAAGG + Intergenic
1165067718 19:33238887-33238909 GTGTGGGCAGGAGGTGGGGATGG - Intergenic
1165068496 19:33242029-33242051 GTATGGGCAGGAGGTGGGGACGG - Intergenic
1165381902 19:35487682-35487704 GTGTGGGCATTAGGAGGGTATGG - Intronic
1165666004 19:37629250-37629272 TGGTGGGGGTGAGGGGGGTAGGG - Intronic
1165782533 19:38442588-38442610 TTGAGGGCCTGTGGGGGGCAGGG - Intronic
1165996811 19:39849450-39849472 GTGTGGCCATGATTGGGGGAGGG - Intergenic
1166829465 19:45630095-45630117 TGGTGGGCATGGGGGGAGGATGG - Intronic
1166865017 19:45830520-45830542 TTGTGGGCACGAGTGGAGGAGGG + Intronic
1168265997 19:55224448-55224470 TGGTGGGGATGAGGCGGGGTGGG - Intergenic
1168317776 19:55491527-55491549 TGGTGGGAAGGAGGGAGGGAGGG + Intronic
1168538655 19:57192230-57192252 TTGGGGGCCTGAGGGGGGAAGGG + Intronic
1168723755 19:58569690-58569712 TTGTGGGCTTGGGTTGGGGAGGG + Intronic
925178519 2:1801163-1801185 TTGTGGGCATGGAGGGGGTTAGG + Intronic
925840153 2:7984421-7984443 ATGTGTGCATGAGGGACGGAAGG - Intergenic
926006641 2:9378086-9378108 TTGTGGGCATGGGGAGCGGGGGG - Intronic
926681157 2:15665166-15665188 GTGCGGCCATGAGGTGGGGAGGG + Intergenic
931717036 2:65037447-65037469 TTGTGGTGATGGGGGAGGGATGG - Intergenic
932211096 2:69931306-69931328 GGGTGGGCAGGAGGTGGGGATGG - Intronic
932236587 2:70125368-70125390 GTGTGGGCGTCAGGGGGAGACGG - Intergenic
932753251 2:74386145-74386167 TTGTGGGCATGATGGTGGCATGG - Intronic
932815738 2:74860182-74860204 TGGGGGGCATGAGGGTAGGAGGG + Intronic
932880352 2:75495339-75495361 TTGTGAGCATGAGGATGAGATGG + Intronic
933446658 2:82388222-82388244 GAGTGGGGATGAGGTGGGGATGG + Intergenic
933583885 2:84159429-84159451 GTGTGGGGAAGAGGGAGGGATGG + Intergenic
933779702 2:85792965-85792987 TGATGGGCATGAAGGGGGGCAGG - Intergenic
933809109 2:86021408-86021430 GTGGGGGCAGGAGGTGGGGAGGG + Exonic
934108711 2:88721572-88721594 ATGTGTGCATGTGGGGGGGGGGG - Intronic
934612235 2:95749023-95749045 TAGTGGGGGTGAGGTGGGGATGG + Intergenic
934772236 2:96914341-96914363 GTGCGGGCATGAGGGAGGGTGGG + Intronic
934841917 2:97630433-97630455 TAGTGGGGGTGAGGTGGGGATGG - Intergenic
934921621 2:98348562-98348584 CTGTGGGAATGAGGGAGGAAGGG - Intronic
934939494 2:98490112-98490134 GCTTGGGCATGAGGGAGGGAGGG + Intronic
934949709 2:98567819-98567841 TTGTGGACACCAGGGGTGGATGG + Intronic
935363571 2:102267686-102267708 TTCTGAGAATGAGGGAGGGAAGG - Intergenic
935578463 2:104735083-104735105 TTGTGTGCATGTGTGTGGGAGGG - Intergenic
935639239 2:105275072-105275094 TTGTGGGCCTGGAGGAGGGAGGG - Intronic
936522648 2:113220714-113220736 TTGTGTGCATGGGGGGCTGAGGG + Intronic
937460959 2:122085561-122085583 TTGGGGGCATGGCAGGGGGAAGG - Intergenic
937777046 2:125790276-125790298 TTTTGGGCATGATGTGAGGAAGG - Intergenic
937857691 2:126684468-126684490 TAGTGGGCATGGTGGTGGGAGGG - Intronic
938368625 2:130755467-130755489 TTGTGGGGAGGAGGGGGGAGCGG - Intronic
938387107 2:130874384-130874406 TTGTGGGCCTGAGGAGGGCCTGG - Intronic
940311142 2:152280009-152280031 TTGTTGGCAGGAGTGGGGGTAGG - Intergenic
940830179 2:158457418-158457440 TTGTGCGCCTGCCGGGGGGAGGG - Intronic
940898447 2:159103922-159103944 GTGTGGGCAGGAGGAGGGCATGG + Intronic
941650196 2:168084172-168084194 AGGTGGGCATGGTGGGGGGAAGG + Intronic
942543038 2:177034670-177034692 TTGTGGGATGGGGGGGGGGAGGG - Intergenic
943470953 2:188292693-188292715 ATGTGGGCATGGGGGTGGGGAGG + Intronic
944119709 2:196227729-196227751 AGGTGGGGATGAGGAGGGGAAGG - Intronic
944183744 2:196926124-196926146 CTCTGGGCATGAGGGGGGCTGGG + Intronic
944503588 2:200386831-200386853 ATGTGTGTATGAGAGGGGGATGG - Intronic
945005759 2:205403979-205404001 TTGTGTGCATGAGGGGTGCTGGG - Intronic
946156180 2:217808217-217808239 ATGGGGGAATGAGGGGGGAATGG - Intronic
946812319 2:223538963-223538985 TTGTGGGGATAATGGGGGTAGGG + Intergenic
946890950 2:224276096-224276118 TTGTGGGGATGTGGGGGGAGGGG - Intergenic
947509369 2:230736684-230736706 TCGTGGTCAGGAGGAGGGGAAGG + Intronic
948085762 2:235245655-235245677 TGGTGGGGACGAGGGGGAGATGG + Intergenic
948484668 2:238272699-238272721 TTGCGGTCATGAGGGGGAGCTGG - Intronic
948856435 2:240732537-240732559 ATGAGGGAATGAGGGAGGGATGG + Intronic
949009118 2:241668413-241668435 CAGTGGGCAGGAGGTGGGGAGGG - Intronic
1169197103 20:3689262-3689284 ATGGGGGCAGGAGGTGGGGAGGG - Intronic
1169343489 20:4813139-4813161 TTCTGGGAATGGGGTGGGGATGG - Intronic
1169430496 20:5531917-5531939 CTGTGGGCTTGAGGGTGGGGTGG - Intergenic
1169837287 20:9894448-9894470 TTGTGTGTGTGAGGGAGGGAGGG + Intergenic
1169883476 20:10372666-10372688 TCGGGGGGAGGAGGGGGGGAGGG - Intergenic
1170764142 20:19275632-19275654 TTGTGGGGAGGAGGGCGGTAGGG + Intronic
1170950317 20:20930769-20930791 TGGTGGGGATAAGGAGGGGATGG - Intergenic
1172590890 20:36117108-36117130 TGGTGGGCAAGAGCAGGGGAGGG - Intronic
1173757978 20:45534998-45535020 TTTTGGGAAAGAGGGTGGGAAGG - Intronic
1174134967 20:48373256-48373278 TTGTGCGAATGAGGCGGGGGAGG - Intergenic
1174298039 20:49562633-49562655 GTGTGGGCAGGAGCCGGGGATGG - Intronic
1174513330 20:51072594-51072616 TTCTGGGTTTGAGAGGGGGAAGG + Intergenic
1175353080 20:58340084-58340106 TTGTGGGGTTGAGGGGAGAAAGG + Intronic
1176050968 20:63119637-63119659 TTGTGGGCTGGAGGCAGGGAGGG - Intergenic
1176077377 20:63254556-63254578 TTGCGGGGAGGAGGGGGGAACGG - Intronic
1176523544 21:7846881-7846903 TTGTGGGGTGGAGGGGGGGAGGG + Intergenic
1176569466 21:8402097-8402119 TGGTGGGGGTGTGGGGGGGAGGG + Intergenic
1177123946 21:17172544-17172566 TTGTGGGGAGGGGGGAGGGATGG - Intergenic
1177440529 21:21117210-21117232 CTGTGAGCATGAGGGAGGTAGGG - Intronic
1178246420 21:30957250-30957272 ATGTAGGCAGGAGGTGGGGAGGG + Intergenic
1178357564 21:31921435-31921457 TTGGGGGCTTGAGTGGGGGAAGG + Intronic
1178558513 21:33616072-33616094 TGGTGGGGTTGGGGGGGGGAGGG - Intronic
1178657564 21:34476893-34476915 TTGTGGGGTGGAGGGGGGGAGGG + Intergenic
1179350492 21:40606265-40606287 TTGGGGCCACGAGGGGGTGATGG + Intronic
1179452451 21:41475345-41475367 GTGAGGGCGTGAGGGGGTGAGGG + Intronic
1179627824 21:42658499-42658521 TCGTGGGCAGGAGAGGGGAAAGG - Intronic
1180061716 21:45388692-45388714 TTATGGGCCTGAGGGTGGGGAGG - Intergenic
1180651401 22:17380115-17380137 TTCTGGGCATCAGTGGAGGAGGG + Intronic
1181106239 22:20577406-20577428 TGGTGGGAAGGAGGGAGGGAGGG - Intronic
1181428640 22:22862268-22862290 TTGTGGGGATGAGGGGTAGTTGG + Intronic
1181628488 22:24137428-24137450 TTGTGTGCCTGTGGGAGGGAAGG + Intronic
1181821222 22:25477164-25477186 CAGTGAGCATGAGAGGGGGAAGG + Intergenic
1181918426 22:26299467-26299489 GTGTGGGGAGGAGGGAGGGATGG - Intronic
1182032878 22:27173976-27173998 TTGTGGGGGAGAGGGGGAGATGG - Intergenic
1182476102 22:30577122-30577144 TTGTTGGCCTGTGAGGGGGAAGG + Exonic
1182492612 22:30683424-30683446 TGGAGGGGATGAGGGAGGGATGG - Intergenic
1183247050 22:36702142-36702164 TTGAGGGGATGAGGGGGTGGCGG + Intronic
1183340722 22:37279596-37279618 TTGTGGGAAAGAGGGAGGGGAGG + Intergenic
1183669487 22:39264102-39264124 TTGTGGGTATGAGAGAGGCAGGG - Intergenic
1183807079 22:40220469-40220491 TGGTGGGGAGGAGGGGGGGAGGG + Intronic
1184148959 22:42627609-42627631 CTGTGGGCATGATCGCGGGAGGG - Exonic
1184334860 22:43847173-43847195 ACGTGGGCATCAGGGAGGGAGGG + Intronic
1184642362 22:45879407-45879429 GTGTGGGAAGGAGGGAGGGAAGG - Intergenic
1185129621 22:49031792-49031814 TGGAGGGCATGACGGTGGGAAGG - Intergenic
1185154275 22:49183760-49183782 TTGGGGGCAGGCGGGTGGGAAGG + Intergenic
1203255435 22_KI270733v1_random:135399-135421 TGGTGGGGGTGGGGGGGGGAGGG + Intergenic
949482707 3:4509313-4509335 TTTTGGACATGTGGAGGGGATGG + Intronic
950705036 3:14774329-14774351 TTGTGCTCAGGAGGGGAGGAGGG - Intergenic
951831174 3:26928907-26928929 TTGTGGGGTGGGGGGGGGGAGGG + Intergenic
951842611 3:27050188-27050210 TTGTGGGCATTAGAGGCAGAGGG - Intergenic
952534840 3:34298371-34298393 TTGTGGGCAGGGGTGAGGGAAGG - Intergenic
952561321 3:34596852-34596874 TTGTGTGTATGAGGAGGGTATGG + Intergenic
953232854 3:41079933-41079955 TTGTAGGTAAGAGGGGAGGAAGG + Intergenic
953827654 3:46267968-46267990 TTGTGGACAGGAGGGTGGCATGG + Intergenic
954133025 3:48569698-48569720 GTGTGGGCATGGGGAGGGCAGGG - Intronic
954202281 3:49030847-49030869 TTGTGGGAAGGAGGGGCAGAGGG - Intronic
954835014 3:53458818-53458840 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
956050264 3:65240503-65240525 CTGTGGGAATGAGGGAGGTAGGG - Intergenic
956588867 3:70892623-70892645 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
956648300 3:71478913-71478935 TTGTTGAAAGGAGGGGGGGAGGG + Intronic
956788526 3:72662398-72662420 GGGTGGGCATGATGGGGGGAGGG - Intergenic
957327993 3:78720941-78720963 TTGTGGGGTTGGGGGGGGGGCGG + Intronic
959380726 3:105638270-105638292 TTGTGGGGTCGGGGGGGGGAGGG + Intergenic
959513428 3:107240160-107240182 TGGGGGGGTTGAGGGGGGGAGGG - Intergenic
959917382 3:111830863-111830885 TTGTCAGCATGAGGGGCGGTGGG + Intronic
961325887 3:126109141-126109163 TTGATGGCATGAAGGAGGGAAGG - Intronic
961445021 3:126976356-126976378 GTGTGGGCAGGTGGGGGGCAGGG + Intergenic
961851267 3:129821700-129821722 TTGTGAGTTTGAGGGTGGGATGG - Intronic
961945492 3:130682657-130682679 TAGAAGGCATGAGGGGAGGAGGG - Intronic
962300990 3:134243062-134243084 TGGTGGGGAGGAGGGGTGGAGGG - Intronic
962532982 3:136300954-136300976 TTGTGGGAATGGGGTGGGAAAGG - Intronic
962716128 3:138127664-138127686 TTATGGGCATAGGGTGGGGATGG - Intronic
963202349 3:142598321-142598343 TTGTGGGAGGGAGTGGGGGAAGG + Intronic
963912810 3:150829307-150829329 TTGTGGGAATGAGGTGGGGGAGG - Intergenic
964607387 3:158572497-158572519 TTGGGGGCATGAGGTGTGGGAGG + Intronic
965211049 3:165790059-165790081 GTGTGTGTGTGAGGGGGGGATGG + Intronic
965372384 3:167879679-167879701 TTGTGTGCATGAGGGGAGAGAGG - Intergenic
965525056 3:169707205-169707227 TCGTGGGGTTGAGGGGAGGAGGG + Intergenic
965939471 3:174160906-174160928 TTGAGGGCAGGAGGTGGGTATGG - Intronic
966893512 3:184425497-184425519 TTGTGGACTTCAGGGAGGGAGGG + Intronic
967982391 3:195073478-195073500 TTGTGGGCATGAGGGGGGGAGGG - Intronic
968287440 3:197517281-197517303 GGGTCGGCCTGAGGGGGGGATGG - Intronic
968287455 3:197517334-197517356 GGGTCGGCCTGAGGGGGGGATGG - Intronic
968287751 3:197518402-197518424 AGGTCGGCCTGAGGGGGGGATGG - Intronic
968287780 3:197518510-197518532 GGGTCGGCCTGAGGGGGGGATGG - Intronic
968515406 4:1013534-1013556 ATGTGGGCAGGCGGGGGGTAGGG - Intronic
968534820 4:1117718-1117740 TTTTGGGGTTGAGGGGGTGAAGG - Intergenic
968569924 4:1334018-1334040 TGGTGGGCATGGGGTGGGCATGG - Intronic
968569956 4:1334116-1334138 TGGTGGGCATGGGGTGGGCATGG - Intronic
968614836 4:1572731-1572753 GTGGGCGCATGAGGGTGGGAGGG + Intergenic
968649336 4:1754200-1754222 CTGGGGGCATGTGGGGAGGAGGG + Intergenic
968699542 4:2048026-2048048 CTGTGGGGATGAGGTGGAGAGGG + Intergenic
968747984 4:2370794-2370816 GTGTGGGCAGGAGGGGTGGCCGG - Intronic
969467517 4:7366471-7366493 TTGGGGGAGAGAGGGGGGGAGGG - Intronic
969530909 4:7729664-7729686 TTGTGGGCCTGGGAGGGGGCAGG - Exonic
969898634 4:10328133-10328155 CTGTGACCATGAGGGGTGGAAGG - Intergenic
970437153 4:16046914-16046936 GTTTGGGAATGAGGGTGGGAAGG - Intronic
972184948 4:36517452-36517474 TTTTGTGCATTAGGGGAGGAAGG + Intergenic
973570477 4:52233937-52233959 TTGTGTGTGTGGGGGGGGGAGGG + Intergenic
976082942 4:81376048-81376070 CTGTGTGCTTGAGGCGGGGAGGG - Intergenic
976512438 4:85927331-85927353 ATGGGGGGATGAGGGGGTGATGG + Intronic
976517236 4:85982917-85982939 TTGTTGGGAGAAGGGGGGGAAGG - Intronic
977316999 4:95462893-95462915 TAGGGGTCATGAGGGGGTGATGG + Intronic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
978955515 4:114607904-114607926 TTGTGGGCAGTAGGAGGTGATGG - Intronic
979667320 4:123326512-123326534 TTGTTGGCATGCGTGGGGGAAGG - Intergenic
980544899 4:134246617-134246639 TTGTGGGGAGGGGGGGGGGAGGG - Intergenic
980554840 4:134389729-134389751 TTATGGGCATAATTGGGGGATGG + Intergenic
982467404 4:155747965-155747987 TTGTGGGCGGGGGGGGGGGGGGG - Intergenic
982899650 4:160981838-160981860 CTGTGGGCATTGGGGGTGGAGGG + Intergenic
983338445 4:166425843-166425865 TTGTGGGGATGAGGGTTGGATGG - Intergenic
984686715 4:182677263-182677285 TAGTGGGCATGATGGTGGGGAGG - Intronic
985516103 5:345488-345510 ATGTGTGTATGTGGGGGGGAGGG + Intronic
985978770 5:3444899-3444921 TTGTGGGGTGGCGGGGGGGAAGG + Intergenic
986415669 5:7525873-7525895 ATCTGTGCATGAGGAGGGGATGG - Intronic
986841926 5:11707331-11707353 CTGTGTGCATGAGAGGAGGATGG - Intronic
988461300 5:31440238-31440260 TTATGGAAATGAGGGTGGGATGG - Intronic
989100890 5:37822073-37822095 CTGTGGGCCTGAGAGGGAGATGG + Intronic
989101668 5:37829202-37829224 TTGTGACCATGATGTGGGGAAGG - Intronic
989248709 5:39282568-39282590 TAATGGGCATGAGGTGGGGGTGG + Intergenic
989645183 5:43623197-43623219 ATGTGGGCATGATGGGTGGGTGG + Intronic
990301970 5:54458456-54458478 TAGTGGGCAAGAGGGGAGAATGG + Intergenic
990854560 5:60249254-60249276 GTGTGGGCATGAGAGGGAAATGG - Intronic
992841415 5:80698801-80698823 TTGTGGGGTGGTGGGGGGGACGG + Intronic
993310770 5:86329524-86329546 TTCTGGGCAGTAGGAGGGGAGGG - Intergenic
993510668 5:88767918-88767940 CTGTGGGCATGAGGAAGGGCCGG - Intronic
994188512 5:96841536-96841558 TTGTGGGCATTGTGGGGGGGTGG - Intronic
994357694 5:98812510-98812532 TTGTGGGCCTGAGGCAGGTATGG - Intergenic
995081840 5:108060715-108060737 TTGTGTGTGGGAGGGGGGGATGG - Intronic
997361190 5:133296140-133296162 TTTTGGGCATGAGGACTGGAAGG - Intronic
997619193 5:135273734-135273756 TTGGGGGCATGGGAGGGGAAAGG + Intronic
997795565 5:136806432-136806454 CTGTGGGGATGAGGTGGGGGTGG + Intergenic
997957066 5:138287135-138287157 TTGTGGCCATTAGTAGGGGAGGG - Intronic
998226832 5:140333577-140333599 TTGTGGGGATGAGGAGTGGAGGG + Exonic
998288740 5:140891401-140891423 TTGGGGGCAAGAGTGGGGGGTGG - Intronic
998368899 5:141648925-141648947 ATGAGGGCATGAGTGGGGGCAGG - Intronic
998732044 5:145089595-145089617 TTGTGGGGGTGTGGGGGGGCAGG + Intergenic
999269768 5:150289960-150289982 GTGTGGGCCTGGGGGTGGGATGG + Intronic
999299443 5:150482074-150482096 CTGTGGGAATGTGGAGGGGAAGG - Intergenic
999451963 5:151685319-151685341 TAGAGGGCATGACGTGGGGATGG - Intronic
999473253 5:151874921-151874943 TAGGGAGCATGAGGAGGGGAAGG + Intronic
1000009383 5:157217424-157217446 TTGTGGGCTTGAGGAGGGGGTGG - Intronic
1000219585 5:159200118-159200140 TTGGGGGCAGGTGGGGAGGATGG - Intronic
1000951210 5:167485566-167485588 TTTGGGGCAGGAGGGGGGCAGGG + Intronic
1001148151 5:169202955-169202977 TTGTGGGCATCAGGGGCATATGG - Intronic
1001203541 5:169741210-169741232 TGGTGGGGAAGAGGTGGGGATGG + Intronic
1001332602 5:170772780-170772802 GTGTGTGCATGTGGAGGGGAAGG + Intronic
1001450759 5:171822670-171822692 TTGTGGCCAAGAGGGAGGGCAGG - Intergenic
1001518448 5:172373649-172373671 TGGTTGGCAGGAGGGAGGGAAGG - Intronic
1001644371 5:173269254-173269276 TTGGGGGCGGGAGGGGTGGAGGG + Intergenic
1001676551 5:173522540-173522562 TCCTGGCCATGAGGCGGGGAAGG - Intergenic
1001933145 5:175687180-175687202 TTGAGGGCATGGAGGGCGGAGGG + Intergenic
1002475387 5:179462185-179462207 GTGTGGGCGTGGTGGGGGGAGGG - Intergenic
1002810423 6:623012-623034 TTCTGAGGATGAGGGAGGGAGGG - Intronic
1003062869 6:2876185-2876207 TTGGGGGGGTAAGGGGGGGATGG - Intergenic
1003613135 6:7630996-7631018 TGGTGGGTATAAGGAGGGGAGGG + Intergenic
1003750377 6:9048542-9048564 TTGTGGGCAGGAGGGTGACATGG + Intergenic
1004637821 6:17485865-17485887 TTCTGAGGATGAGGAGGGGAAGG + Intronic
1005025824 6:21462104-21462126 TGGTGGCCAAGAGGGTGGGAAGG - Intergenic
1005393756 6:25360268-25360290 TTGTATGTATGAGTGGGGGAGGG + Intronic
1005825149 6:29627901-29627923 TTGTGGGGAGGAGGGGGCGAGGG + Intronic
1005859712 6:29890798-29890820 TGGTGGACATGAGGGTGGGTTGG - Intergenic
1005860753 6:29898091-29898113 TGGTGGACATGAGGGTGGGCTGG - Intergenic
1005868948 6:29958867-29958889 TGGTGGACATGAGGGTGGGCTGG - Intergenic
1006091146 6:31629718-31629740 TTGGGGGCATGGGTGGGGGCCGG - Exonic
1006378603 6:33685081-33685103 GAGTGGGCATGATGGGGGCAGGG + Intronic
1007031998 6:38636926-38636948 TTGTGGGCAAGAGAGGGGAGAGG - Intronic
1007231017 6:40347857-40347879 CTGTGGGGAGGAGGGGAGGAGGG - Intergenic
1008231699 6:48990820-48990842 ATGTGGGCCTGAGGCTGGGACGG - Intergenic
1009740930 6:67745636-67745658 TTGTGGGGTTGGGTGGGGGAGGG - Intergenic
1010726410 6:79338857-79338879 TTGTGGGGGTGGGGGGGGGCGGG - Intergenic
1011819388 6:91233195-91233217 ATGTGGTCATGAGGGAGGGTTGG - Intergenic
1012912942 6:105137389-105137411 GTTTGGGCATGAGTGGGGGGCGG + Intergenic
1013658291 6:112268429-112268451 TTGTGGGCTAGAGGGAGAGAAGG + Intergenic
1015575579 6:134667448-134667470 GTGTGGGTATGAGCGGAGGATGG - Intergenic
1016783940 6:147989465-147989487 TTGTGGGCAGGAGACTGGGAGGG - Intergenic
1017361970 6:153584270-153584292 TTGTGAGCAGGTGGTGGGGAGGG - Intergenic
1018052659 6:160024715-160024737 TTGTGGGGCTGAGGGGGTGGTGG + Intronic
1018374877 6:163201511-163201533 CTTTGGGCATGAGGTGGGGCTGG + Intronic
1019125885 6:169839933-169839955 GTGTGGGCATGATGTGGGCATGG - Intergenic
1019125901 6:169840003-169840025 GTGTGGGCATGATGTGGGCATGG - Intergenic
1019734928 7:2645896-2645918 TTCTGGGCCTGAGACGGGGACGG + Intronic
1019807201 7:3136714-3136736 GTGTGGGGATGAGGGAGGGAGGG - Intergenic
1019918243 7:4147101-4147123 CTGTGGGAATGAGGACGGGAGGG + Intronic
1020461661 7:8434807-8434829 TGGTGGGCACGAGGAAGGGACGG + Intronic
1020752773 7:12164021-12164043 TTGGGGGCTTGAGGGAAGGATGG - Intergenic
1022320871 7:29286438-29286460 ATGTGGGGATGGGGTGGGGAGGG + Intronic
1023694677 7:42832751-42832773 TTTTGGGCATGAGTGGGGTGTGG - Intergenic
1023855187 7:44178763-44178785 TTGTGGCCAGGAGGGGAGGTAGG - Intronic
1023855456 7:44180606-44180628 TTGTGGCCAGGAGGGGAGGTGGG + Intronic
1024005697 7:45223871-45223893 TTGTGGGCAGGGGCGGGGAAGGG + Intergenic
1024342475 7:48281602-48281624 TGGTGGGAATGAGGTTGGGAGGG - Intronic
1024598228 7:50957792-50957814 TTGGGGGGAAGAGGGGGGGGTGG - Intergenic
1025120908 7:56301340-56301362 TTGTGGGGATGAAGGTGGGATGG - Intergenic
1026341116 7:69434774-69434796 TTGTGGGAGTGAGGGAGTGAGGG - Intergenic
1026790094 7:73325788-73325810 TTGGGGTCATGAGGTGTGGACGG - Intronic
1026829071 7:73600490-73600512 GTGTGGGCAAGAGGGGGATACGG + Intronic
1027104660 7:75397917-75397939 TTGGGGTCATGAGGTGTGGACGG + Intronic
1028135153 7:87217445-87217467 TTGAGGGCCTGAGGAGGGTAAGG - Intronic
1029312836 7:99683630-99683652 TTTAGGGCATGAGGTGAGGAGGG - Intergenic
1030069956 7:105689761-105689783 ATGGGGGCATGAGGAGGCGAAGG + Intronic
1031409965 7:121429884-121429906 TTGTGTGTGTGGGGGGGGGAGGG - Intergenic
1032699516 7:134366540-134366562 ATGGGGGCATTAGGAGGGGAAGG + Intergenic
1032753188 7:134863170-134863192 ATGTGGGCAGGAGTTGGGGAGGG + Intronic
1033584234 7:142762414-142762436 TTGTGGGAAAGAGGCTGGGAAGG + Intronic
1033705068 7:143878704-143878726 TTGTGGGCATCAGGAGGAGCAGG - Intronic
1034390349 7:150782203-150782225 TTGTGGAGATGAGGATGGGAGGG - Intergenic
1035248569 7:157581379-157581401 CTGTGGGCCTGGGGTGGGGAGGG + Intronic
1035333269 7:158110320-158110342 TTGTGGGCATGAGGCATGCAGGG - Intronic
1036389314 8:8310781-8310803 TTGGGGGAATGAGGTGGGGTGGG - Intergenic
1036600453 8:10255915-10255937 TAGCGGGCATGGTGGGGGGATGG - Intronic
1036646504 8:10614111-10614133 GTGTGGGCATGAGGAGGGCCAGG - Intronic
1037261962 8:17019630-17019652 TGGTGGGCGTGGGGTGGGGAGGG - Intergenic
1040389328 8:46936034-46936056 TTGTGTGCATGAGTGTGGGGTGG - Intergenic
1040975692 8:53191921-53191943 ATGTGTGCATGAGGGGGAGATGG - Intergenic
1041835512 8:62209106-62209128 TTGTGGGACAGAGTGGGGGATGG - Intergenic
1042110245 8:65374017-65374039 TACTGGGCAGGAGGGAGGGAGGG + Intergenic
1043972947 8:86552964-86552986 TTGTGGGCGGGGGGGGGGGGGGG - Intronic
1044085126 8:87934639-87934661 TTGTGGGCATGGGGGTGGGGTGG + Intergenic
1044145501 8:88709129-88709151 TTGTGTGCATGTGGGTGGTAGGG - Intergenic
1044281317 8:90360478-90360500 TTGTGGGGTGGGGGGGGGGAGGG - Intergenic
1044895042 8:96882542-96882564 TTGTGGGCAGGTGGGTGGCAGGG + Intronic
1045392149 8:101726118-101726140 TGGAGGGCATGAGGTGGGGGAGG + Intronic
1046981835 8:120344966-120344988 TTGTGAGCAAGAGGGTGGGGAGG + Intronic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1048391718 8:133973181-133973203 CTGGGGGCAGGAGGGGGGTAGGG + Intergenic
1048664507 8:136645752-136645774 TTGTGTGCATGTGTGGGTGAGGG + Intergenic
1048940313 8:139394940-139394962 ATGTGGGCATGAGGTAGGCAAGG - Intergenic
1049243973 8:141551751-141551773 TTGGGGGCATGAGGGGGTCGGGG - Intergenic
1049865589 8:144933607-144933629 CTGTGGGCAGGAGGGGAGGTTGG - Intronic
1050491565 9:6193977-6193999 TTGTGGGGTGGTGGGGGGGAGGG + Intergenic
1050744806 9:8862916-8862938 TTGTGGGGTGGTGGGGGGGAGGG + Intronic
1050812943 9:9773201-9773223 TTGGGGGGATGAGGAGGGAAAGG - Intronic
1051373803 9:16383183-16383205 TTGTGGGGTGGTGGGGGGGAGGG + Intergenic
1051561589 9:18447459-18447481 CTGTGGGGAAGAGGGAGGGAGGG + Intergenic
1051678375 9:19581443-19581465 TTCTGGGCCTGAGGTGGAGAGGG - Intronic
1052228274 9:26116314-26116336 TTGTGGGCGTGGCAGGGGGAGGG + Intronic
1052326138 9:27218292-27218314 GTCTGGGCATGAGGAGGGGGTGG + Intronic
1052901408 9:33797549-33797571 TTGTGGGAAAGAGGCTGGGAAGG + Intronic
1052908719 9:33860895-33860917 TTGTGGGGAGGGGGTGGGGAGGG - Intronic
1052990820 9:34518523-34518545 TGGTGGGCTTGAGGGGAGGGAGG + Intronic
1053284644 9:36842311-36842333 GTGTGTGCATGAGAGGGGCATGG + Intronic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1054740477 9:68801144-68801166 TTGTGTGTGTGAGGAGGGGATGG + Intronic
1055212817 9:73817976-73817998 TTTTGGGCATGTGGGTGGGGAGG - Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056698537 9:88881331-88881353 TTGTGGGGAAGAGTGGGAGAGGG - Intergenic
1056723293 9:89089744-89089766 TTGGGGGCATGAGGATGGGGAGG + Intronic
1056973044 9:91224836-91224858 TTGTATGCCTGAGGGGTGGAGGG - Intronic
1057998026 9:99837895-99837917 TTGTGGGAATGGGAGGTGGAGGG + Intronic
1058177994 9:101760491-101760513 CTGTGGGAAAGAGGGAGGGATGG + Intergenic
1058506745 9:105674149-105674171 GTGTGGCCATGGGAGGGGGAGGG + Intergenic
1058527075 9:105869774-105869796 GTGTGTGCATGAGTGTGGGATGG + Intergenic
1059525206 9:114984903-114984925 TTGTGGGCATCATGGGTTGAGGG - Intergenic
1059770060 9:117415588-117415610 TTGTGGCCAAGTGGGTGGGAAGG - Intergenic
1061224323 9:129271914-129271936 TTCAGGGCAGGAGGAGGGGAAGG - Intergenic
1061246078 9:129401828-129401850 TTGGGGAGATGAGGGAGGGAAGG - Intergenic
1061921976 9:133787478-133787500 TTTTGGGCATGAGGGCAGGGAGG + Intronic
1062269034 9:135700353-135700375 TTGGGGGGATGACGGAGGGAAGG + Intergenic
1062290035 9:135790284-135790306 GTGTGGGCACGAGGGTGGGGAGG + Intronic
1062446723 9:136598339-136598361 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446751 9:136598437-136598459 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446765 9:136598486-136598508 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446779 9:136598535-136598557 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446792 9:136598584-136598606 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446798 9:136598609-136598631 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062539882 9:137036882-137036904 TGGTGGGCCTGAGCTGGGGAAGG - Exonic
1062694299 9:137865290-137865312 TTGTGGGCAGCAGTGAGGGAAGG + Intronic
1062727132 9:138081012-138081034 TTGTGGGCAGCAGGGAGGGTGGG + Intronic
1203471831 Un_GL000220v1:118534-118556 TGGTGGGGGTGTGGGGGGGAGGG + Intergenic
1185535614 X:859301-859323 TTGTGTGGAAGAGGTGGGGAAGG - Intergenic
1186367180 X:8907789-8907811 TTGTTGGCATGGGGTGGGGATGG - Intergenic
1187400725 X:18957652-18957674 TTGCTGACATGAGGGGAGGAGGG - Intronic
1187849381 X:23576430-23576452 TTTTGGGAGTGAGGGGGGTATGG - Intergenic
1188151940 X:26687196-26687218 TTGTGGGGTCGGGGGGGGGAGGG + Intergenic
1188729895 X:33632671-33632693 TGGTGGGGGTGAGGTGGGGATGG + Intergenic
1189305240 X:39982045-39982067 TTGTGGGCTTGTGGAGGGCATGG - Intergenic
1189935729 X:46066689-46066711 TTGTGGGCCTGAGGTGGCGGTGG - Intergenic
1191726826 X:64290599-64290621 TGGTGGGTATGAGGGGGAGGTGG - Intronic
1192597578 X:72427594-72427616 TTGTGGGGTGGGGGGGGGGAGGG + Intronic
1192637799 X:72836395-72836417 TTGCTGGCATGAGTGGGGAAGGG - Intronic
1192643915 X:72884420-72884442 TTGCTGGCATGAGTGGGGAAGGG + Intronic
1193139734 X:78015232-78015254 TTGTGGGGAGGAGGGAAGGAAGG - Intronic
1193673504 X:84418753-84418775 TGGTGGGGGTGTGGGGGGGAAGG + Intronic
1194038455 X:88910379-88910401 TTGTGGGGTTGGGGGAGGGAGGG + Intergenic
1194494100 X:94588197-94588219 TTCTAGGCATGAGGTGGGGGAGG + Intergenic
1194643920 X:96434908-96434930 GTGTGGGGGTGAGGAGGGGATGG + Intergenic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1194976890 X:100405559-100405581 GTGTGTGTATGGGGGGGGGAGGG - Intronic
1195464703 X:105167626-105167648 ATGTGGGTATGTGGGGGGGTGGG - Intronic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1196976105 X:121159377-121159399 TTGTGGGCATTCTGGGTGGAGGG + Intergenic
1197537088 X:127703864-127703886 TTGTGGGGGGGAGGTGGGGATGG - Intergenic
1197613747 X:128669182-128669204 GTGGGAGCATGAGGGGGGCAAGG - Intergenic
1199975655 X:152893554-152893576 TTGGGGGGATGAGGGGGCGCTGG + Intergenic