ID: 967982419

View in Genome Browser
Species Human (GRCh38)
Location 3:195073589-195073611
Sequence AAGGCTTATCCCCTCTACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967982419_967982424 7 Left 967982419 3:195073589-195073611 CCACGGTAGAGGGGATAAGCCTT 0: 1
1: 0
2: 0
3: 1
4: 42
Right 967982424 3:195073619-195073641 CCTTTAGAAATAATTTCAACTGG 0: 1
1: 0
2: 1
3: 33
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967982419 Original CRISPR AAGGCTTATCCCCTCTACCG TGG (reversed) Intronic
902050528 1:13560737-13560759 AAGGCTCAGCCCCTCAACCCAGG - Intergenic
902050540 1:13560779-13560801 AAGGCTCAACCCCTCAACCCAGG - Intergenic
907460046 1:54600189-54600211 AGGGCTTTTCCCCTGCACCGTGG - Intronic
1063108967 10:3018411-3018433 GAGGCTTCTCTCCTCTACCAAGG - Intergenic
1063144851 10:3287726-3287748 CAGGCTTCTCCGCTCTGCCGTGG - Intergenic
1063928025 10:10999743-10999765 AAGGCTGATCCACTCCACTGTGG + Intergenic
1067465150 10:46492107-46492129 AAGGCTTAGCCCTTCTCCCATGG + Intergenic
1067622037 10:47892494-47892516 AAGGCTTAGCCCTTCTCCCATGG - Intergenic
1076669219 10:132110375-132110397 AAGGCTGAGCCCATCTATCGTGG - Intronic
1103708596 12:122894990-122895012 AAGGGTTGCCCCCTCCACCGAGG - Intronic
1122276145 14:100591785-100591807 AGGGCTAACCCCCTCTGCCGAGG + Intergenic
1141785898 16:86200780-86200802 AGGGCTTCTCCCCTCTCCCCAGG + Intergenic
1148551846 17:48555134-48555156 ATGGCCTATCCCCTCTCTCGGGG - Intronic
1158746122 18:60201843-60201865 AATGCTTCTCCCCTCTCCCAGGG - Intergenic
1162792419 19:13069939-13069961 CAGGGTTATCCCCTCCCCCGGGG + Intronic
929549872 2:42883215-42883237 AAGATTTATCCCCACTACTGTGG - Intergenic
935723851 2:106006041-106006063 AAGGCTTACACCCTCTGCTGAGG + Intergenic
941531340 2:166675125-166675147 AAGGCTTATCCCCTAAGCTGGGG + Intergenic
948315948 2:237028496-237028518 AAGGCTGCTCCCCTCTGCCTGGG - Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1178468828 21:32873464-32873486 AATGCTTTTCCCCTATAGCGAGG + Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
949392536 3:3578654-3578676 AAGCCTCATCCCCGCTAGCGAGG + Intergenic
952970151 3:38645598-38645620 AAGAGTTATTCCCTCTACCCAGG + Intronic
955453197 3:59092752-59092774 AAGGCTAATCTCCTCCACCGGGG + Intergenic
955894531 3:63685423-63685445 AAGGCTTATTCCCACCACGGTGG + Intergenic
967982419 3:195073589-195073611 AAGGCTTATCCCCTCTACCGTGG - Intronic
980787360 4:137572613-137572635 AAAGCCTACCCCCTCTACCAAGG - Intergenic
983204741 4:164900978-164901000 AAGGCTTATACCCACTCCTGAGG - Intergenic
987133851 5:14882932-14882954 AAGGCTTAGCCCCTCCAGAGAGG + Intergenic
988735577 5:34017426-34017448 AAGGCTTTTCCCCTTTGCCCAGG + Intronic
991547692 5:67801578-67801600 AAGACTTATCCCCTCTGTTGGGG - Intergenic
996814728 5:127562473-127562495 TAGGCATATCCCATCTACAGGGG + Intergenic
1007399848 6:41597518-41597540 CTGGCTTATCCCCTCTCCCAGGG - Intronic
1008507560 6:52245852-52245874 AAGGGTCCTCCCCTCTACCCAGG - Intergenic
1029681700 7:102115983-102116005 AAGGCTCTTCCCATCTTCCGCGG + Intronic
1035633265 8:1124912-1124934 AAGGCTCTGCCCCTATACCGAGG + Intergenic
1041627543 8:60047868-60047890 AAAGCTTGTGCCCTCTACCTAGG + Intergenic
1047139493 8:122121373-122121395 ATGGCTTATCCACTCTAAAGTGG + Intergenic
1047398345 8:124524477-124524499 AAGGCCTCTCCCCTCTTCCCTGG - Intronic
1048879139 8:138858883-138858905 AAGGCCTATCTCCTCTCCAGGGG - Intronic
1053312530 9:37028503-37028525 AAGCCTTAGCCCCTCCACCCAGG - Intronic
1062378475 9:136275607-136275629 AAGGTTTATCCCCTCCAGCCAGG + Intergenic
1195652561 X:107300469-107300491 AATCCTAATCCCCTCTACAGAGG - Intergenic