ID: 967983489

View in Genome Browser
Species Human (GRCh38)
Location 3:195079078-195079100
Sequence GGGCCGGGAGATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967983489 Original CRISPR GGGCCGGGAGATGCAAATTG AGG (reversed) Intronic
900647474 1:3715442-3715464 GGGCTGGGAGATGGAGCTTGGGG + Intronic
902988209 1:20168682-20168704 AGGCCGGGAGATGCAGATGATGG + Intronic
906047966 1:42847011-42847033 GGGCGGGGAGAAGCCAATGGCGG - Intronic
906726447 1:48047973-48047995 GGGCCTGGAGCTGGAAAGTGGGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
916577787 1:166082516-166082538 TGGCCTGGAGCTGCAAGTTGAGG - Intronic
919186110 1:194152257-194152279 GAGTAGGGAGATCCAAATTGGGG - Intergenic
922537224 1:226390274-226390296 AGCCAGGGAGATGCAAACTGAGG - Intronic
922822650 1:228494600-228494622 GGGCCTGGAGATGCTAAATGGGG - Exonic
923322298 1:232846638-232846660 GAGCCGGGAGCTGCAATATGAGG - Intergenic
924832625 1:247614249-247614271 GGGGCGGGAGAGGCAAAATCAGG - Intergenic
1072736560 10:97883162-97883184 GGGCTGGGAGATGCTTTTTGAGG + Intronic
1073486117 10:103820251-103820273 GGGCAGGGAGAAGCAGCTTGGGG - Intronic
1076494152 10:130885765-130885787 GGGGCGGCAGATGGCAATTGTGG - Intergenic
1076578515 10:131490459-131490481 GGGCCAGGAGGTGCAAAATGGGG + Intergenic
1079377622 11:19907864-19907886 GGGCAGCAAGTTGCAAATTGTGG - Intronic
1083109456 11:60390655-60390677 GGGGTGGGAGAGGCATATTGGGG + Intronic
1083521925 11:63321415-63321437 GTGCCGGGAGATGTCACTTGAGG - Intronic
1084463325 11:69308267-69308289 GGGTCGGGAGAGGCAAGATGAGG - Intronic
1084687676 11:70706511-70706533 AGGCCCAGAGATGCAAAGTGAGG - Intronic
1087987689 11:104704973-104704995 GTGCTGGTAGCTGCAAATTGTGG - Intergenic
1089618443 11:119708607-119708629 GGGCCGGGGGAGGGAAAATGGGG + Intronic
1093459949 12:19398810-19398832 GGGCCAGGAGATTCAAATACAGG + Intergenic
1100916857 12:99433713-99433735 AGGCCTGGAGATACAAATTTAGG + Intronic
1102439493 12:112950336-112950358 GGGCCAGCAGTTGCAAATTGAGG - Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1115029270 14:28774876-28774898 GGGCAGAGAGAAGCAAAATGGGG - Intronic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1121108646 14:91297053-91297075 GGGTCGGGAGAGGCACAGTGGGG - Intronic
1121175905 14:91890457-91890479 GGGCCGGGAGCTGGAATTTGAGG + Intronic
1121505626 14:94474582-94474604 GGGTGGGGAGAAGCAAAGTGGGG - Intronic
1121617103 14:95320255-95320277 GGGCCGGGTGACGCAACTGGGGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1126736820 15:51738465-51738487 GGGCAGGGAGATGCGATTTCAGG - Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1132031489 15:98441657-98441679 GTGTCAGGAGATGCAAAGTGAGG + Intronic
1136712718 16:32253361-32253383 GGGCTGGGAGATGCAGGGTGAGG - Exonic
1136755198 16:32676068-32676090 GGGCTGGGAGATGCAGGGTGAGG + Exonic
1136812915 16:33194301-33194323 GGGCTGGGAGATGCAGGGTGAGG - Exonic
1136819391 16:33304381-33304403 GGGCTGGGAGATGCAGGGTGAGG - Exonic
1136825954 16:33360916-33360938 GGGCTGGGAGATGCAGGGTGAGG - Exonic
1136831020 16:33459687-33459709 GGGCTGGGAGATGCAGGGTGAGG - Exonic
1141212796 16:81996635-81996657 GGGCTGGGAGATGAAAATGGAGG + Exonic
1202991492 16_KI270728v1_random:17271-17293 GGGCTGGGAGATGCAGGGTGAGG - Intergenic
1203057340 16_KI270728v1_random:936407-936429 GGGCTGGGAGATGCAGGGTGAGG + Intergenic
1143688528 17:8539549-8539571 TGGCCTGGAAATGCAGATTGGGG - Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146728480 17:35174438-35174460 GGGCAGGGAGATAGAAATGGTGG + Intronic
1149338511 17:55662662-55662684 GGGGCTGGAGAAGCAAACTGAGG - Intergenic
1151894213 17:76969258-76969280 GGGCCGAAAGATGCAAATGAAGG - Intergenic
1158577276 18:58649145-58649167 GGGCCTGGAGATACAACTTGTGG + Intergenic
1161899158 19:7104961-7104983 GAGCCAGGAAATGCAAATTCTGG - Intergenic
1166053447 19:40274775-40274797 GGGCCGGGAGATGTAGCTAGAGG + Intronic
1166683989 19:44784257-44784279 GGGCCGGAAGATGTAACTGGAGG - Exonic
928934908 2:36665658-36665680 GAGACGGAAGATGCAGATTGAGG + Intergenic
929193090 2:39157868-39157890 GGGGAGGGAGGTGCAGATTGTGG + Intergenic
930002523 2:46870736-46870758 GTGGCAGGAGATGGAAATTGCGG - Intergenic
935115918 2:100136191-100136213 GGGCTGGGAGATGTAAGTTTGGG + Intronic
935416240 2:102822182-102822204 GGGCCTGGAGATGCACACTGGGG + Intronic
936401953 2:112171355-112171377 GGGCCGGGAGAGGCAGACTTCGG + Intronic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1169317957 20:4609011-4609033 GAGCTGGGATGTGCAAATTGGGG - Intergenic
1170728987 20:18955811-18955833 GAGCCAGGAGCAGCAAATTGGGG + Intergenic
1174965946 20:55214838-55214860 GGGCCGAGAGAAGAAAATCGTGG + Intergenic
1180619669 22:17152624-17152646 GGTCCTGGAGATGAAAATTTTGG + Intronic
1180831579 22:18909663-18909685 GGGCTGGGAGCTGCAAATGGGGG + Intronic
1181068274 22:20316725-20316747 GGGCTGGGAGCTGCAAATGAGGG - Intronic
1203281663 22_KI270734v1_random:134934-134956 GGGCTGGGAGCTGCAAATGGGGG + Intergenic
949144449 3:680244-680266 GGACCAGGAGATGCAGATTTTGG + Intergenic
950779379 3:15378222-15378244 GGGCAAGCTGATGCAAATTGAGG + Intergenic
952933878 3:38380274-38380296 GGGCCGGGGGAGGCAAAAGGAGG + Intronic
955579957 3:60408255-60408277 GAGACTTGAGATGCAAATTGAGG + Intronic
959771232 3:110099863-110099885 GGGCTGGTAGAAGCAAATTCAGG + Intergenic
962352720 3:134667383-134667405 GTGGCGGGAGAGGCAAATTCAGG + Intronic
964007670 3:151851588-151851610 GCGCCTGGAGATGCCACTTGAGG + Intergenic
966212095 3:177463964-177463986 GGGCCGGGAGATGAAAATAGAGG - Intergenic
967983489 3:195079078-195079100 GGGCCGGGAGATGCAAATTGAGG - Intronic
970673316 4:18419992-18420014 GGTCTGGGCAATGCAAATTGTGG - Intergenic
982571135 4:157051994-157052016 AGGCCGGGAGAAGGAAAGTGGGG - Intergenic
983882339 4:172947393-172947415 GGACAGGGACATGCAATTTGAGG + Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
988996463 5:36719674-36719696 AGGTTGGGAGATGCAAAGTGAGG - Intergenic
990185809 5:53207743-53207765 GGGCCAGGGGATGCCAAATGAGG + Intergenic
991278736 5:64884335-64884357 GGCCAGGCAGATGCAAAATGTGG + Intronic
994198780 5:96949224-96949246 GGTCCTTGACATGCAAATTGGGG - Intronic
998402226 5:141853840-141853862 GGGCTGGGAGATGGAAATGAGGG + Exonic
1003655266 6:8001383-8001405 AGGGCTGGAGATACAAATTGGGG + Intronic
1006364758 6:33608794-33608816 GGGGCGGGAGAGCCAAAGTGGGG - Intergenic
1006601410 6:35228962-35228984 GGGCCAGGAGATGGGAATAGTGG + Intronic
1006730101 6:36230296-36230318 GGGCAGAGGGAAGCAAATTGGGG - Intronic
1007431702 6:41780609-41780631 GGGCCTGGAGCTGCAGATTGGGG - Intronic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1012821873 6:104094738-104094760 GGGCCTGGTGAAACAAATTGTGG - Intergenic
1017725068 6:157271348-157271370 TGGCCTGGAGATGTAAATTTTGG + Intergenic
1032439837 7:131934140-131934162 AGGCCAGTAGATGCAAAGTGAGG - Intergenic
1035422387 7:158740472-158740494 GAGACGGGACATGCAAATTCGGG - Intronic
1036175999 8:6539129-6539151 GGGCTGGGAGATGCGGATTTTGG + Intronic
1039067453 8:33621394-33621416 GGGCAGGGAGGTGGAAAGTGGGG - Intergenic
1039954666 8:42197716-42197738 GGGCCGGTAGAGGCAGATAGAGG - Intronic
1042674650 8:71306503-71306525 GGGCCTGGAGATGCCACTCGGGG + Intronic
1043428388 8:80171276-80171298 GATCCGGGAGATGCAACTTGCGG + Intronic
1043524978 8:81086742-81086764 AGCCAGGGAAATGCAAATTGAGG + Intronic
1044620428 8:94186125-94186147 GGGTCAGGAGATACAGATTGGGG - Intronic
1046607032 8:116382627-116382649 GGGCAGGGAGATGGAAAAGGTGG - Intergenic
1051347276 9:16163552-16163574 AGGGCTGGAGATACAAATTGGGG + Intergenic
1053378139 9:37625811-37625833 GGGCCTGGAGGAGCAAACTGTGG - Intronic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1056170372 9:83979803-83979825 GGGCCGGGAGACCCAAGGTGAGG + Intronic
1061194561 9:129100704-129100726 GGGCGGGGAGACGCAAAATGGGG + Intronic
1062395025 9:136349401-136349423 GGGCCGGGAGAGGCAGGGTGGGG - Intronic
1188609454 X:32078038-32078060 GGGCTGGCAGATGCACATTAAGG - Intronic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1196441234 X:115721898-115721920 GGGAGGGGAGATGCAAATAAAGG - Intergenic
1196444763 X:115839885-115839907 GGGAGGGGAGATGCAAATAAAGG - Intergenic