ID: 967983797

View in Genome Browser
Species Human (GRCh38)
Location 3:195080764-195080786
Sequence GCGGATTGATGGAGTCTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 60}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967983797_967983803 4 Left 967983797 3:195080764-195080786 CCAGTTAGACTCCATCAATCCGC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 967983803 3:195080791-195080813 GCGCCCTTCACCCTCATGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 88
967983797_967983804 5 Left 967983797 3:195080764-195080786 CCAGTTAGACTCCATCAATCCGC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 967983804 3:195080792-195080814 CGCCCTTCACCCTCATGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 95
967983797_967983812 30 Left 967983797 3:195080764-195080786 CCAGTTAGACTCCATCAATCCGC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 967983812 3:195080817-195080839 TGTTCCAACCCAGGAGCCAGAGG 0: 1
1: 3
2: 76
3: 812
4: 13390
967983797_967983802 1 Left 967983797 3:195080764-195080786 CCAGTTAGACTCCATCAATCCGC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 967983802 3:195080788-195080810 CCAGCGCCCTTCACCCTCATGGG 0: 1
1: 0
2: 3
3: 10
4: 150
967983797_967983805 6 Left 967983797 3:195080764-195080786 CCAGTTAGACTCCATCAATCCGC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 967983805 3:195080793-195080815 GCCCTTCACCCTCATGGGAGGGG 0: 1
1: 0
2: 1
3: 17
4: 184
967983797_967983800 0 Left 967983797 3:195080764-195080786 CCAGTTAGACTCCATCAATCCGC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 967983800 3:195080787-195080809 ACCAGCGCCCTTCACCCTCATGG 0: 1
1: 0
2: 0
3: 10
4: 152
967983797_967983807 7 Left 967983797 3:195080764-195080786 CCAGTTAGACTCCATCAATCCGC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 967983807 3:195080794-195080816 CCCTTCACCCTCATGGGAGGGGG 0: 1
1: 0
2: 1
3: 11
4: 183
967983797_967983811 21 Left 967983797 3:195080764-195080786 CCAGTTAGACTCCATCAATCCGC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 967983811 3:195080808-195080830 GGGAGGGGGTGTTCCAACCCAGG 0: 1
1: 0
2: 2
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967983797 Original CRISPR GCGGATTGATGGAGTCTAAC TGG (reversed) Intronic
900282488 1:1880019-1880041 GAGGATTGATGGAGCCTGGCAGG - Intronic
920411577 1:205765653-205765675 GAGGATTGATTGAGTCTAGGAGG + Intergenic
920455232 1:206096052-206096074 GTGGATTGTTTGAGTCTAAGAGG - Intronic
921372981 1:214444619-214444641 GCAGATTGCAGGAGTCTAAGGGG + Intronic
1072090628 10:92123612-92123634 GCTGACTGAGGGAGTGTAACAGG - Intronic
1074891046 10:117736870-117736892 GCGGAATGAGGGAGTCTGAGGGG + Intergenic
1079903851 11:26221510-26221532 GCAGATTGATGGAATCTCACAGG + Intergenic
1090910823 11:131117880-131117902 GCTGACTGATGGAGGCTAACAGG + Intergenic
1091037993 11:132251198-132251220 TTGAAGTGATGGAGTCTAACAGG - Intronic
1093999620 12:25680888-25680910 GAGGATTGCTGGAGTCTGGCAGG + Intergenic
1097521817 12:60679723-60679745 GGAGAGTGATGGAGTGTAACAGG - Intergenic
1109661120 13:65461979-65462001 GCAGAATGGTGGAGTTTAACTGG - Intergenic
1113843871 13:113375179-113375201 GGGGACTGATGGAGTCTGATGGG + Intergenic
1113843893 13:113375259-113375281 GGGGACTGATGGAGTCTGATGGG + Intergenic
1113843915 13:113375339-113375361 GGGGACTGATGGAGTCTGATGGG + Intergenic
1113843935 13:113375419-113375441 GGGGACTGATGGAGTCTGATGGG + Intergenic
1113843955 13:113375499-113375521 GGGGACTGATGGAGTCTGATGGG + Intergenic
1113843976 13:113375579-113375601 GGGGACTGATGGAGTCTGATGGG + Intergenic
1113843996 13:113375659-113375681 GGGGACTGATGGAGTCTGATGGG + Intergenic
1113844017 13:113375739-113375761 GGGGACTGATGGAGTCTGATGGG + Intergenic
1113844115 13:113376108-113376130 GGGGACTGATGGAGTCTGATGGG + Intergenic
1117025456 14:51615552-51615574 GCAGAATGATGTGGTCTAACTGG - Intronic
1119573827 14:75700388-75700410 GCAAAATGATGGAGTTTAACTGG + Intronic
1120296415 14:82647474-82647496 GCGGAATGGTGGCGTTTAACAGG + Intergenic
1124266760 15:28242461-28242483 GTGGATAGATGGAAACTAACGGG + Intronic
1133369459 16:5237055-5237077 GAGGATTGATGGAGCCCAAGAGG + Intergenic
1134272706 16:12747340-12747362 GAGGATTGATTGAGCCTGACAGG + Intronic
1137389962 16:48073067-48073089 GAGGATTGATGGGGTCTCAAAGG - Intergenic
1141407008 16:83803444-83803466 GAGGATTGCTGGAGTCTGAGAGG + Intergenic
1150264561 17:63823961-63823983 GTGGATTGAGGGAGTAAAACCGG + Intronic
1151791516 17:76308419-76308441 GGGGATGGATGGAGTCTAGCTGG - Intergenic
1152830186 17:82492442-82492464 GAGGATTGATTGAGTCTGAGAGG - Intergenic
1153239615 18:3018601-3018623 GAGGATTGATTGAGCCTAAGAGG + Intergenic
1165644372 19:37421837-37421859 GAGGATTGATTGAGTCTAAGAGG - Intronic
1165998711 19:39864348-39864370 GAGGATTGATTGAGTCTAGGAGG - Intronic
925571321 2:5315724-5315746 GGGGCTTGATGGATTCTAAAAGG - Intergenic
931814310 2:65885689-65885711 GGGGATTGAAGGAGACTAATTGG - Intergenic
939642378 2:144656025-144656047 AGGGACTGATTGAGTCTAACAGG + Intergenic
941627202 2:167843358-167843380 GTGGCATGATGGAGTCTGACAGG - Intergenic
1174175531 20:48642240-48642262 GAGCATTGATGGAGTCCACCTGG + Exonic
1178453373 21:32725928-32725950 GCGGATTGATTGAGTCTGGAAGG - Intronic
952486794 3:33820192-33820214 GAGGATTGATTGAGTCCAAGAGG + Intronic
962830497 3:139134939-139134961 GCTGATTGGTGGAAACTAACTGG - Intronic
963023641 3:140897478-140897500 GCAAAATGATGGAGTTTAACTGG - Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
967983797 3:195080764-195080786 GCGGATTGATGGAGTCTAACTGG - Intronic
969335717 4:6508696-6508718 GCAAAATGATGGAGTTTAACTGG + Intronic
972046369 4:34669936-34669958 GAGGATTGCTTGAGTCTAACAGG - Intergenic
972690404 4:41391765-41391787 ACAGATTGATGGAGACTAAGGGG + Intronic
974713187 4:65630299-65630321 GAGAAGTGATGGAGTTTAACTGG + Intronic
984490366 4:180426973-180426995 GCAGCTTGGTGGAGTCCAACTGG - Intergenic
994829164 5:104755829-104755851 GGGAATTGATGGAGTTTAATAGG - Intergenic
1015576667 6:134679011-134679033 GCAGATTCATGGATTCTGACTGG - Intergenic
1016539909 6:145152592-145152614 GAGGATTGATTGAGCCTAAAAGG + Intergenic
1019521617 7:1463220-1463242 GAGGATTGATGGAGGCTGAGAGG + Intergenic
1019743343 7:2686442-2686464 GAGGATTGCTGGAGTCTAGGAGG + Intronic
1027746881 7:82086686-82086708 GGGGATTAATGAAGTCTATCTGG - Intronic
1033166069 7:139039715-139039737 GAGGATTGCTTGAGTCTAAGAGG + Intergenic
1034075398 7:148226576-148226598 GCAAAATGATGGAGTTTAACGGG + Intronic
1034454478 7:151159472-151159494 GAGGATTGCTGGAGTCTGAGAGG - Intronic
1039363681 8:36907682-36907704 AGGCATTGATGAAGTCTAACAGG - Intronic
1041914754 8:63127634-63127656 GCGCATTGCTGGAGTCCACCTGG + Intergenic
1045299601 8:100899806-100899828 GCAGAGTGAGAGAGTCTAACGGG + Intergenic
1060077210 9:120602666-120602688 GAGGTTTGTTGGAGTCTAAGAGG - Exonic
1186685321 X:11919388-11919410 GCTGTTTGATGGATTCTAATGGG - Intergenic
1193732371 X:85116584-85116606 GCAAAATGGTGGAGTCTAACTGG - Intergenic