ID: 967986073

View in Genome Browser
Species Human (GRCh38)
Location 3:195096154-195096176
Sequence CTTTTCTGCTTAAGGTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967986073_967986076 21 Left 967986073 3:195096154-195096176 CCCTTTGACCTTAAGCAGAAAAG 0: 1
1: 0
2: 0
3: 11
4: 184
Right 967986076 3:195096198-195096220 TATAGAGTACCTGCTAAGCCTGG 0: 1
1: 0
2: 3
3: 9
4: 91
967986073_967986078 23 Left 967986073 3:195096154-195096176 CCCTTTGACCTTAAGCAGAAAAG 0: 1
1: 0
2: 0
3: 11
4: 184
Right 967986078 3:195096200-195096222 TAGAGTACCTGCTAAGCCTGGGG 0: 1
1: 1
2: 0
3: 3
4: 94
967986073_967986077 22 Left 967986073 3:195096154-195096176 CCCTTTGACCTTAAGCAGAAAAG 0: 1
1: 0
2: 0
3: 11
4: 184
Right 967986077 3:195096199-195096221 ATAGAGTACCTGCTAAGCCTGGG 0: 1
1: 0
2: 1
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967986073 Original CRISPR CTTTTCTGCTTAAGGTCAAA GGG (reversed) Intronic
902980439 1:20118987-20119009 TTGGTCTGCTTAAGATCAAATGG + Intronic
903911344 1:26728258-26728280 CTGTTCTTCTTAATATCAAAGGG - Intronic
905085408 1:35371034-35371056 CTTTTCTTCTTAACCTTAAATGG + Intronic
906001005 1:42424887-42424909 CTTCTTTTCTTAAGGTCAGATGG + Intergenic
910568022 1:88667210-88667232 CTTTTCAGCTAAAGGTATAAGGG + Intergenic
914895430 1:151667436-151667458 CTTTTATTGTTAAGGCCAAAAGG - Intronic
917289554 1:173458499-173458521 CTTATCTGCTTAAGCTCTAAAGG - Intergenic
918275517 1:182950454-182950476 CTTCTCTGCTAAAGATCACAAGG + Intronic
919427585 1:197451775-197451797 CTTTTCTTCTTAATGTCATATGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921763380 1:218942143-218942165 CTTTACTGTTTAAAGTGAAATGG - Intergenic
922943986 1:229494579-229494601 CTTTAATGCTCAAGGTCACATGG - Intronic
1063280393 10:4623120-4623142 CTTTTCTACTTGAAGACAAATGG - Intergenic
1067262599 10:44707320-44707342 CTTTCCTCCTTAGGGTCTAACGG - Intergenic
1070277862 10:75024961-75024983 CTTTTCTTCTTTAGTACAAAAGG - Exonic
1070342184 10:75507821-75507843 CTTCTGTGCCTAAGGACAAATGG - Intronic
1073079494 10:100849851-100849873 CTTTTCTGCTTAATATAGAATGG + Intergenic
1075034939 10:119057196-119057218 TTTTTTTCCTTATGGTCAAATGG - Intronic
1082318415 11:50761709-50761731 CTTTTCTGCCTATGGTGGAAAGG - Intergenic
1085020882 11:73206640-73206662 CTTTACTGCATAAGGTTGAAAGG + Intergenic
1085452430 11:76642892-76642914 CTTTGATGCTCATGGTCAAAAGG - Intergenic
1085708592 11:78809283-78809305 CTTTGCTTCTGAAGGTCAACTGG + Intronic
1088415507 11:109584504-109584526 CCTTTCTGATTAAGGGGAAAAGG + Intergenic
1090416279 11:126542718-126542740 CTTATTTGCATAAGGTCCAAAGG - Intronic
1091163632 11:133450086-133450108 CTTTTGTTCTTATGGTCACAAGG - Intronic
1092644623 12:10557001-10557023 ATTTTCTAATTAAGTTCAAATGG - Intergenic
1094314748 12:29127290-29127312 ATGTTCTTCTTAAGGTCATATGG - Intergenic
1095572198 12:43696255-43696277 CCTTTCTGCTTGAGTGCAAAAGG - Intergenic
1096145739 12:49277435-49277457 CTTTGCTATTTAAGGTCAATGGG - Intergenic
1096710864 12:53454408-53454430 TTTTTCTGCTGAAGGACAAGTGG + Intronic
1097824681 12:64162942-64162964 CCTTTCTGCTTAAAATCAATTGG + Intergenic
1097862162 12:64528650-64528672 CTCTTCTGCTTAATGCTAAAGGG - Intergenic
1099661556 12:85569404-85569426 CTGTTCTACTTGAGGTCACATGG - Intergenic
1101402021 12:104396848-104396870 TTTTTCTGCTTAATGACCAATGG - Intergenic
1101583303 12:106063242-106063264 CTTTTGTGCTTAAGCTCATTTGG + Intergenic
1101723574 12:107371495-107371517 CTTTACTGCTTAAAATCAGAGGG - Intronic
1102602046 12:114038608-114038630 GTTTTGTGCTTAAGTTTAAATGG + Intergenic
1102803065 12:115753881-115753903 CATTTCTACTTAAGATCAAATGG + Intergenic
1106607237 13:31240218-31240240 ATTTTCTGCTTTAGACCAAATGG + Intronic
1107704891 13:43092137-43092159 TTTTTTTGCTTATGGTGAAAAGG + Intronic
1108941931 13:55966061-55966083 CTTTTGTGTGTATGGTCAAATGG + Intergenic
1109851339 13:68068508-68068530 CTTTTCTTCTCAAGTTCACATGG - Intergenic
1110727825 13:78846111-78846133 CATTCTTGCTTAAGGTCATAAGG + Intergenic
1110865756 13:80393886-80393908 TTTTGCTGCTTATAGTCAAATGG + Intergenic
1112588212 13:100738505-100738527 CTTTTCCTCTTTAGGCCAAAGGG + Intergenic
1119690241 14:76666056-76666078 TTTTTCTGCAAAAGATCAAATGG - Intergenic
1121563379 14:94890979-94891001 CTTTTCTGCTAACGGTGACAGGG + Intergenic
1121858597 14:97294251-97294273 CTTATTTGCTCAAGGTCACAGGG - Intergenic
1123950478 15:25267760-25267782 GCTATCTGCTTAAGATCAAAAGG + Intergenic
1125188581 15:36962853-36962875 ATTTTCTGCTTAGAGTCTAAAGG - Intronic
1126954919 15:53922586-53922608 ATTTTCTGCTTAATATAAAAAGG - Intergenic
1127663032 15:61118331-61118353 CTTTTGTGCTTTAGTTCACAGGG - Intronic
1134267918 16:12707619-12707641 CTTTTCTGTTTATGGTCATTAGG - Intronic
1139168882 16:64606004-64606026 ATTTTCTGCTTAAGACCAAGAGG - Intergenic
1140732616 16:77870426-77870448 CTTTTCTTGGCAAGGTCAAAGGG + Intronic
1140777300 16:78261590-78261612 CTTTTTTTCCTAAGGTTAAAAGG - Intronic
1143664819 17:8351243-8351265 CTTTTCTGCTTAAGTTAACCAGG + Intergenic
1147016668 17:37497450-37497472 CTTTTTTGATGAATGTCAAAAGG + Intronic
1150520523 17:65863262-65863284 CTTTTATGCTTAAGGTCTTATGG - Intronic
1151131297 17:71899522-71899544 CATTTCTTCTTAAGATTAAATGG - Intergenic
1152987785 18:335222-335244 CTTTTATGCTTTAGGTCCACCGG - Exonic
1154578605 18:16069131-16069153 CTTTCCGGCCTAAGGTGAAAAGG + Intergenic
1157464017 18:47929681-47929703 TTTTTCTGTTTAGGATCAAAAGG + Intronic
1158316059 18:56212413-56212435 CTTTTCTGCTTAGGTTGAATTGG - Intergenic
1158682058 18:59577222-59577244 CTTTTCTGCCTAAGTTCGCATGG - Intronic
1158787638 18:60735006-60735028 TTTTTTTGCTTAAGTTAAAATGG - Intergenic
1158804626 18:60955377-60955399 CTTTCCTTTTTAAGGCCAAATGG - Intergenic
1159500394 18:69261647-69261669 CTTTTGTGGTCCAGGTCAAAGGG + Intergenic
1159897049 18:74007382-74007404 CTTTTCTTCTTAATGACAATGGG - Intergenic
926849617 2:17180637-17180659 CTTTTCTCCTTGAAATCAAAGGG + Intergenic
927317896 2:21706881-21706903 CTTTTTTACCTAAGGACAAATGG - Intergenic
928214989 2:29353974-29353996 CTCTTGTGCTTAAGGACCAAAGG - Intronic
931376236 2:61710910-61710932 CTTTCCAGCATAAGGTCCAAAGG + Intergenic
932895198 2:75632693-75632715 CTTTTCTTCTTAACAGCAAAAGG + Intergenic
934943278 2:98518196-98518218 ATTTGCTGGTTAACGTCAAAAGG - Intronic
935856581 2:107281260-107281282 GTTTTCTGCTTAGGAACAAAAGG + Intergenic
937622510 2:124004981-124005003 ATTTGCTGCTGAAGGACAAACGG + Intergenic
939114589 2:138045829-138045851 TTTTTCTGCTTAAGGTCCTTAGG - Intergenic
941045166 2:160666658-160666680 CTTTTCTTCCTTTGGTCAAAAGG - Intergenic
941655058 2:168134398-168134420 CAGCTCTGCTTGAGGTCAAAGGG - Intronic
942314373 2:174683830-174683852 CCTTTCTGCTTTAATTCAAAGGG - Intergenic
943295743 2:186135912-186135934 TTATTCTGCTTACAGTCAAATGG + Intergenic
943356944 2:186867680-186867702 CTCTTCTTCTTAAGGTCAATCGG + Intergenic
945258871 2:207825822-207825844 ATTTTCTGCTTATTTTCAAAAGG - Intergenic
945395902 2:209317188-209317210 CTTTTCTCCTTAAAGTCAGAGGG - Intergenic
945990028 2:216388421-216388443 CTTTGCTCCTTTAGGTCTAAAGG - Intergenic
946011860 2:216571733-216571755 ATTTTCTGCTCAATGCCAAATGG + Intronic
947348184 2:229215537-229215559 CTGCTCTGCTTATGGTCAAGGGG - Intronic
948102722 2:235388222-235388244 CTTTTCTTCCCTAGGTCAAAAGG + Intergenic
1168960251 20:1864165-1864187 CTTTTCTGTTTCAGGACACATGG - Intergenic
1170693005 20:18631906-18631928 CTCTTCTTGTTTAGGTCAAAGGG + Intronic
1171142929 20:22758550-22758572 CCTTTCTGCTGAAGGACACAAGG + Intergenic
1172153743 20:32809373-32809395 CTTTTCTTCTGCAGGTCAGATGG + Intergenic
1172584500 20:36073271-36073293 CTTTTCTGCTAAAGGTAGCAGGG - Intergenic
1176694828 21:9962707-9962729 AGTTTCTGCTTAACATCAAAGGG + Intergenic
1176956277 21:15107869-15107891 CTTTTCTGGCAAGGGTCAAAGGG + Intergenic
1177412504 21:20748600-20748622 ATTATCTGCCTAAAGTCAAAGGG + Intergenic
1178770613 21:35500385-35500407 CATTCCTTCTTAATGTCAAATGG + Intronic
1182019182 22:27066568-27066590 CTTTGCTGCTTGAAGTCCAAGGG - Intergenic
1182045157 22:27268465-27268487 CTGCTCTCATTAAGGTCAAAAGG - Intergenic
1183770722 22:39923265-39923287 CTGTTCTGCTGAAGGTCAGTAGG + Intronic
949734151 3:7151684-7151706 CTTTTTTCCTAAAGGGCAAAGGG - Intronic
950585454 3:13889172-13889194 CATTTTTGCTTATGGTCATAAGG + Intergenic
952733558 3:36665435-36665457 CTTTTCTTTATAAGGTCATAGGG - Intergenic
953401674 3:42627512-42627534 CATTTCTGTATAAGGGCAAAAGG + Intronic
953480420 3:43246720-43246742 CTTCTCTGCATAAGGCCAAGAGG - Intergenic
958497952 3:94869037-94869059 CTTTTCTGCTGAAGATAAAGAGG - Intergenic
960807321 3:121596763-121596785 CTTTTTTTTTTAAGGTGAAAAGG - Intronic
960927829 3:122813661-122813683 CTTTTCCGCTTAATACCAAAGGG + Intronic
962491068 3:135894523-135894545 CTTTGCTGCCTAAGGTGACAGGG - Intergenic
965439036 3:168690807-168690829 ATTTTCTGCTTATGGAAAAATGG - Intergenic
966282264 3:178245629-178245651 CTTTTCACCCTAGGGTCAAAGGG + Intergenic
967805406 3:193711127-193711149 CTTTTCTTCTTCTTGTCAAAGGG - Intergenic
967986073 3:195096154-195096176 CTTTTCTGCTTAAGGTCAAAGGG - Intronic
972397914 4:38673044-38673066 CTTTTCTGCTTATTTTTAAAGGG + Intronic
973225974 4:47785464-47785486 CTCTTCTGCATGAGGGCAAAGGG - Intronic
974045859 4:56897988-56898010 CTTCTCTGTTTAAGGTGCAAGGG - Intergenic
974097722 4:57383284-57383306 CTTTTCTTCTAAACTTCAAATGG - Intergenic
974120618 4:57633639-57633661 CTTTTCTTCTAAAGGTCAGATGG + Intergenic
975412073 4:74065046-74065068 CCTTTCTGCTTAGGAACAAAAGG - Intergenic
976304363 4:83545004-83545026 CTTTTCTGCTGAAGGCTAATTGG + Intronic
977719935 4:100228202-100228224 ATTTTCTACTTAGGGTCATAAGG + Intergenic
979304214 4:119123707-119123729 CTTTGCTGCTTATAGTCATAAGG + Intergenic
980367456 4:131822928-131822950 AGTTTCTGCTTAACATCAAAGGG + Intergenic
980381482 4:132025430-132025452 ATTTTCTCCTTAAGTTCACATGG - Intergenic
980459029 4:133081168-133081190 CATTTCTCCTGAAGGTAAAATGG - Intergenic
981606307 4:146545167-146545189 CTTTTCTGCCTATTTTCAAAGGG + Intergenic
981758410 4:148167037-148167059 CTATTCTGCTTATGTTCTAATGG + Intronic
986152784 5:5142559-5142581 CTCTTCTGCTCCAGGTCAGAGGG - Intronic
987747941 5:22001426-22001448 GTTTACTGCATAAGGTGAAATGG - Intronic
987971823 5:24956017-24956039 TTTTTCTGTTAAAGGTCATATGG - Intergenic
988988517 5:36645633-36645655 CTTTTTTGTTGATGGTCAAAAGG - Intronic
989763711 5:45052243-45052265 CTTTTCTGCTTATTTTAAAAAGG - Intergenic
991214308 5:64144629-64144651 CTTTGCTGCTTCAGGACTAAGGG - Intergenic
993419605 5:87684585-87684607 CTCTACTGCTTAAGCTCATATGG + Intergenic
993620338 5:90160987-90161009 CTTGTCTGCTTAAGACCTAAAGG + Intergenic
994264107 5:97694129-97694151 CTTTTAAGCTTACTGTCAAATGG - Intergenic
999678510 5:154031922-154031944 CCTTTCTGCTTAGGAACAAAAGG - Intronic
999900535 5:156081723-156081745 CTTTTCTCTGTAAGGGCAAAGGG + Intronic
1001888281 5:175316111-175316133 CTTTTCTGCTTACATTCAAGGGG - Intergenic
1002321738 5:178380467-178380489 TTTTTCTGCTGAAGGGGAAAAGG + Intronic
1002775383 6:323977-323999 CTTTTCTTCTTCAGGGCATAGGG - Intronic
1004791917 6:19035916-19035938 CTTTTTTGCTTAATACCAAATGG - Intergenic
1005421593 6:25656706-25656728 TTCTTTTGCTTTAGGTCAAAGGG + Intronic
1006145032 6:31953823-31953845 CTCTTCTGCTTCAGCTCAACGGG - Exonic
1006254016 6:32814940-32814962 ATTTTCTGCTTTAGGATAAATGG - Intronic
1006651715 6:35557169-35557191 TTTTCCTGCTTAAAGTCAGAAGG - Intergenic
1008299557 6:49818437-49818459 CTTTTCTTCCTTAGGACAAATGG - Intergenic
1009389876 6:63133253-63133275 ACTTTGTGATTAAGGTCAAAGGG - Intergenic
1011236100 6:85218746-85218768 TTTGTCTGCTTAAGGTCCTAGGG - Intergenic
1012481464 6:99671961-99671983 ATTTTTTGTTTAAGGTCTAAGGG + Intergenic
1012723414 6:102778477-102778499 TTTTTCTGCTAAAGGAGAAAAGG - Intergenic
1013168022 6:107611099-107611121 CTTTACTTCTGAAGGTCAAATGG + Intronic
1015010149 6:128336133-128336155 CTTTTCTGGTTATGTTTAAAAGG - Intronic
1016270728 6:142286928-142286950 CTTTACTGCTAAAGCTAAAAAGG + Intergenic
1018753659 6:166829799-166829821 CTTTTCTTCTTAAGGCTGAACGG - Intronic
1020962770 7:14826657-14826679 TTTATTTGCCTAAGGTCAAAGGG - Intronic
1023333871 7:39148110-39148132 CTTTTCTGCTGATGGGCAGAAGG - Intronic
1028938124 7:96488571-96488593 CCTTTCTGCTTGAGGTCAGAAGG + Intronic
1030397154 7:109000754-109000776 CTTTTCTGCATAAACTTAAAAGG + Intergenic
1031514649 7:122687060-122687082 CCTTTCTGCTGAAGTTCAAAAGG - Intronic
1032554484 7:132817445-132817467 CTATTCTCCTTAGGGACAAAAGG + Intronic
1032938772 7:136764699-136764721 CTTATCTGCTTAAGGAGACATGG + Intergenic
1033851053 7:145495752-145495774 CTTTTCTGATTAAATTCAAGAGG - Intergenic
1035966950 8:4203141-4203163 CTTTTCTGGCTCAGGTCAGAGGG + Intronic
1037484962 8:19338519-19338541 CTTTCCTGGTTGAGGTCAGAGGG + Intronic
1038732363 8:30138899-30138921 CTTTTCTTCTGAAGAACAAAAGG - Intronic
1040751808 8:50718574-50718596 CTTTTCTTGTAAAGGGCAAAGGG + Intronic
1042013160 8:64273346-64273368 GTTTGCAGCTTAAGTTCAAATGG - Intergenic
1042857214 8:73279537-73279559 GTTATCTTCTTAGGGTCAAAGGG + Intergenic
1042945466 8:74149864-74149886 CCTTTATGTTTAAGATCAAAGGG + Intergenic
1043029883 8:75120962-75120984 CTTTTATCCTTAAGGATAAAAGG + Intergenic
1043277454 8:78417544-78417566 CTATTTTGCTTCATGTCAAAAGG - Intergenic
1047509389 8:125504814-125504836 GTCTTCTGCTTATTGTCAAAGGG + Intergenic
1050220830 9:3387879-3387901 CTTTTCTGTTCAGGGTCAAGAGG - Intronic
1050769967 9:9185639-9185661 ATTTTCTACTTCAGATCAAAAGG - Intronic
1051889218 9:21925723-21925745 CTTTTCAGCTTAAGGCCATCAGG - Intronic
1053631799 9:39948648-39948670 AGTTTCTGCTTAACATCAAAGGG + Intergenic
1053773962 9:41514881-41514903 AGTTTCTGCTTAACATCAAAGGG - Intergenic
1054212088 9:62302050-62302072 AGTTTCTGCTTAACATCAAAGGG - Intergenic
1054312896 9:63546780-63546802 AGTTTCTGCTTAACATCAAAGGG + Intergenic
1055663282 9:78528639-78528661 ACTTTCTGCCTAAGGACAAAGGG - Intergenic
1055669063 9:78582334-78582356 CTTTTCTGTAAAAGGCCAAATGG + Intergenic
1055907278 9:81309262-81309284 ATTTTCTGCAAAAGGTCAGATGG + Intergenic
1058509324 9:105699567-105699589 CTTTTCTGCCTAAGGTGTGAAGG + Intronic
1059694041 9:116713938-116713960 CTTATCTGCTCAAGGTTACATGG - Intronic
1060683115 9:125583397-125583419 CCTTTCTGTTTAAGGTAAATAGG - Intronic
1186030442 X:5363302-5363324 TTTTTCTGCTGAACATCAAAAGG + Intergenic
1186113946 X:6285307-6285329 CTTTTCTGTTTAATTTGAAAAGG + Intergenic
1188720934 X:33522441-33522463 CACTTCTGATTCAGGTCAAATGG - Intergenic
1188858832 X:35231622-35231644 CTTTTCTTCTTATGTTCAAAGGG - Intergenic
1194074098 X:89367427-89367449 CTTTTCTTTTCAAGGTTAAAAGG + Intergenic
1196735563 X:118978218-118978240 CTTTTCTACTGGAGATCAAAAGG - Intronic
1199204070 X:145126687-145126709 CTTTTCTGGTCAAGGTCATGTGG + Intergenic
1200729490 Y:6718954-6718976 CTTTTCTTTTCAAGGTTAAAAGG + Intergenic
1201462801 Y:14245966-14245988 CTTTTCTGCTTAGCTTCAGAGGG - Intergenic