ID: 967986783

View in Genome Browser
Species Human (GRCh38)
Location 3:195101086-195101108
Sequence GTGGATTACAGCAGTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967986783_967986787 6 Left 967986783 3:195101086-195101108 CCAGCCTCACTGCTGTAATCCAC 0: 1
1: 0
2: 1
3: 19
4: 232
Right 967986787 3:195101115-195101137 CCTCCCAGCACGTGACAGTGAGG 0: 1
1: 0
2: 4
3: 16
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967986783 Original CRISPR GTGGATTACAGCAGTGAGGC TGG (reversed) Intronic
900407448 1:2498816-2498838 GTGGACGACAACGGTGAGGCTGG + Exonic
903852013 1:26313182-26313204 ATGGAATACAGCAGGGAGGGAGG - Intronic
904148097 1:28411314-28411336 TTGGATTACAGGTGTGAGCCCGG + Intronic
904842595 1:33382839-33382861 GTGGATTACAGCTGTGACAGAGG + Intronic
905976743 1:42181032-42181054 GTGGCAGACAGCAGTGAGGAAGG - Intronic
906404859 1:45533780-45533802 TGGGATTACAGCCGTGAGTCTGG + Intergenic
907040131 1:51251447-51251469 GTGGATGACACCAGTGCAGCGGG - Intronic
907111249 1:51928401-51928423 GTTTATTAAAGCTGTGAGGCTGG - Intronic
907525047 1:55049232-55049254 GTGGATTGAAGCTGTGAGGCAGG + Intronic
907634001 1:56114790-56114812 GTGGATTATAGAAGTTAGGCTGG - Intergenic
915492926 1:156261453-156261475 GTGGAGAACAGCAGTGAGCAAGG + Intronic
916875450 1:168963824-168963846 ATGGATTAGATCACTGAGGCTGG - Intergenic
917165498 1:172107976-172107998 GTTGATCAGAGCAGTCAGGCAGG + Intronic
917580202 1:176369339-176369361 GTGGATTCCAGCAGTGGGGCAGG + Intergenic
921358926 1:214312695-214312717 GTGGCTAAGTGCAGTGAGGCAGG + Intronic
922780006 1:228244514-228244536 GGGGAGTACAGCTGTGAGGCTGG + Exonic
922780125 1:228245631-228245653 GGGGAGTACAGCTGCGAGGCTGG + Exonic
922780248 1:228246746-228246768 GGGGAGTACACCTGTGAGGCTGG + Exonic
922781574 1:228256869-228256891 GGGGAGTACAGCTGCGAGGCGGG + Exonic
922783062 1:228268748-228268770 GGGGAGTACAGCTGCGAGGCAGG + Exonic
922783561 1:228272164-228272186 GGGGAGTACAGCTGCGAGGCTGG + Exonic
922783866 1:228273490-228273512 GGGGAGTACAGCTGTGAGGCGGG + Exonic
923025107 1:230197527-230197549 GGGGGTTACATCAGAGAGGCAGG + Intronic
923788404 1:237090383-237090405 GAGGATTACATGAGGGAGGCAGG + Intronic
1062834996 10:629577-629599 ACGGGTTAAAGCAGTGAGGCTGG - Intronic
1062835012 10:629654-629676 GCGGGTTAAAGCAGTGAGGCCGG - Intronic
1063078050 10:2736170-2736192 GAATAGTACAGCAGTGAGGCCGG + Intergenic
1064446932 10:15403240-15403262 GTAAAATTCAGCAGTGAGGCTGG - Intergenic
1065867521 10:29926793-29926815 CTGGCTTTCAGCAGTGCGGCAGG - Intergenic
1066228059 10:33403828-33403850 CTGGAGCACAGCAGTGAGGTGGG + Intergenic
1067121583 10:43476760-43476782 GTGCAGGACAGCAGTGAGCCAGG + Intronic
1067805920 10:49393888-49393910 GTGGACTGCAGCAGTGAGTTAGG - Intronic
1068492097 10:57737387-57737409 TGGGATTACAGGCGTGAGGCTGG + Intergenic
1070117655 10:73544210-73544232 TGGGATTACAGGAGTGAGCCCGG + Intronic
1071529933 10:86381340-86381362 GTGGATTTCAGCAGTTGGGGAGG - Intergenic
1076001099 10:126913626-126913648 GTGGATAACTGCAGAGTGGCAGG - Intronic
1076215493 10:128690071-128690093 GTGGTTTCCAGCAGTGAGAATGG + Intergenic
1076640616 10:131914223-131914245 TGGGATTACAGGTGTGAGGCCGG - Intronic
1080568679 11:33536197-33536219 TTGTATTACAGCACTGAGCCAGG - Intergenic
1080603568 11:33844618-33844640 ATGGAATACAGCAGTACGGCGGG - Intergenic
1080653019 11:34237623-34237645 TGGGATTACAGAAGTGAGCCTGG - Intronic
1083220077 11:61246513-61246535 TGGGATTACAGCACTGAGGCGGG + Intronic
1083960870 11:66014206-66014228 TGGGATTACAGGTGTGAGGCCGG - Intergenic
1084599131 11:70134433-70134455 GAGGTTTAGAGCAGTGAGGTGGG - Intronic
1085150821 11:74251703-74251725 GTGGATTCCAGTGGTAAGGCGGG + Exonic
1087274448 11:96146705-96146727 TCTGAATACAGCAGTGAGGCAGG + Intronic
1087755890 11:102054434-102054456 GTAGATAAGAGAAGTGAGGCTGG + Intronic
1088736183 11:112729505-112729527 TGGGATTACAGGAGTGAGCCAGG - Intergenic
1091677858 12:2504374-2504396 TTGGGTTACAGCAAAGAGGCAGG - Intronic
1094477773 12:30854601-30854623 TGGGATTACAGGAGTGAGCCTGG - Intergenic
1096561668 12:52439977-52439999 CTGGGATACAGCAGTGAGGGAGG + Intergenic
1096571425 12:52525548-52525570 GTAAATGACAGCATTGAGGCTGG + Intergenic
1096906431 12:54941079-54941101 GTGGAATACGGCAGTGGGGACGG - Intergenic
1097022065 12:56027561-56027583 GTGGATTAGAGGTGTGTGGCAGG - Intronic
1097024806 12:56046907-56046929 TGGGATTACAGCCGTGAGCCAGG - Intergenic
1098170140 12:67738366-67738388 TGGGATTACAGGCGTGAGGCAGG + Intergenic
1098884878 12:75950733-75950755 TGGGATTACAGGAGTGAGCCAGG + Intergenic
1100020097 12:90058392-90058414 TGGGATTACAGGAGTGAGCCAGG + Intergenic
1100214967 12:92438199-92438221 GTGGAATACACCATTCAGGCAGG + Intergenic
1100635917 12:96434392-96434414 GTGGATTACAGTGGTCAGGAAGG + Intergenic
1101019040 12:100533341-100533363 GGGGATGACAGCATTCAGGCAGG + Intronic
1103822559 12:123710729-123710751 AGGGATTACAGGAGTGAGCCAGG + Intergenic
1104104561 12:125646588-125646610 GTGGATTCCCACAGTGAAGCAGG - Intronic
1104756181 12:131270704-131270726 GTGGATTGCAGCAGCCAGGGTGG - Intergenic
1104777596 12:131400321-131400343 GTGGATTGCAGCAGCCAGGGTGG + Intergenic
1112228706 13:97566571-97566593 GTGGATTTCAGCTGAGATGCTGG - Intergenic
1112591818 13:100770374-100770396 GTGCATGAGAGCAGAGAGGCAGG - Intergenic
1113355225 13:109572662-109572684 GTGGAATACAGCATTCAGGAGGG + Intergenic
1113583928 13:111449730-111449752 GAGGCTGACAGCACTGAGGCTGG - Intergenic
1114039405 14:18662532-18662554 TTGGATTACAGGTGTGAGCCTGG - Intergenic
1114601623 14:23960010-23960032 GGGGATTAAAGCAGGGGGGCCGG + Intronic
1115523834 14:34259573-34259595 ATGGATTACAGGTGTGAGCCAGG + Intronic
1117991150 14:61435207-61435229 GGGGATTACAGAAGTGAGACAGG - Intronic
1118046793 14:61978768-61978790 GTGGACTAAAGCAGTGAGGGAGG - Intergenic
1123833522 15:24165790-24165812 GTGGCTGAGAGCAGTGTGGCAGG + Intergenic
1123840256 15:24240841-24240863 GTGGCTGAGAGCAGTGTGGCAGG + Intergenic
1123853194 15:24381366-24381388 GTGGCTGAGAGCAGTGTGGCAGG + Intergenic
1123869163 15:24553917-24553939 GTGGCTGAGAGCAGTGTGGCAGG + Intergenic
1124244300 15:28056676-28056698 GTGGAGCTCAGCAGTGATGCAGG - Intronic
1125728552 15:41880442-41880464 GTGGGGCCCAGCAGTGAGGCAGG - Intronic
1127262138 15:57334434-57334456 GTGGATGCCAGCAGTCAGGATGG + Intergenic
1128343802 15:66841431-66841453 ATGGTTTACAGCAGGGAGGTGGG - Intergenic
1129715113 15:77843199-77843221 TGGGATTACAGGTGTGAGGCTGG - Intergenic
1130767568 15:86887378-86887400 GTGGATGTGAGCAGTTAGGCAGG - Intronic
1130841009 15:87701305-87701327 GGGGCTTGCAGCAGTGGGGCTGG - Intergenic
1131570471 15:93529999-93530021 TTGGATCACAGAAATGAGGCAGG - Intergenic
1132247299 15:100307459-100307481 AGGGTTTACAGCAGTGTGGCTGG - Intronic
1135071926 16:19359725-19359747 GTGGAATACAGATGTGATGCTGG + Intergenic
1135582434 16:23640158-23640180 GGGGATTACAGGCGTGAGCCAGG + Intronic
1136460869 16:30409312-30409334 GTGCACTGCAGCAGTGAGGGTGG + Intronic
1137549739 16:49429292-49429314 CTGGAATGCAGCAGTGGGGCAGG - Intergenic
1137809990 16:51343504-51343526 GTTGATTTCAGCACTGGGGCAGG + Intergenic
1141722461 16:85764225-85764247 GGGGATTACAGGCGTGAGCCTGG - Intergenic
1142407308 16:89897708-89897730 GTGGCTAACAGCACTCAGGCTGG - Intronic
1143067483 17:4261856-4261878 GTTGCTCACAGGAGTGAGGCGGG - Intronic
1143919992 17:10323486-10323508 TTGGATTACAGGTGTGAGCCCGG - Intronic
1146890657 17:36504387-36504409 GTGGTTCACAGCTGAGAGGCAGG + Intronic
1148711459 17:49684389-49684411 GTGGATCGCATCAGTGAGGAGGG - Intergenic
1148863862 17:50618623-50618645 GTGGAATAGAGGGGTGAGGCTGG - Intronic
1149684698 17:58528701-58528723 GTGGATTTGTGCAGAGAGGCAGG - Intronic
1150697799 17:67420726-67420748 GTAGAAAACAGAAGTGAGGCCGG - Intronic
1151598769 17:75093806-75093828 GTGGAGCACAGCCGTGAGGATGG - Exonic
1152488703 17:80614009-80614031 GTGGAGTGCAGCAGTGTCGCCGG - Intronic
1152563316 17:81089394-81089416 GTGGACCACAGCACTGAGGCAGG - Intronic
1155426927 18:25716559-25716581 CTGCAAGACAGCAGTGAGGCTGG + Intergenic
1155544971 18:26905233-26905255 GTAGATTACATGAGTGAGGAAGG + Intergenic
1156327160 18:36085176-36085198 GTAGGTGACAGCAGTGACGCAGG - Intergenic
1157481139 18:48054510-48054532 GTAGACAACAGCAGGGAGGCAGG - Intronic
1160489445 18:79324974-79324996 GTGGAGTAAACCAGTGGGGCTGG + Intronic
1160956778 19:1697243-1697265 GTGGAGTCCAGAGGTGAGGCTGG + Intergenic
1162051951 19:8039697-8039719 GTGGATTACAGCACTTTGGGAGG - Intronic
1162413563 19:10520406-10520428 TGGGATTACAGGAGTGAGACAGG + Intergenic
1163121491 19:15220913-15220935 TGGGATTACAGGAGTGAGCCCGG + Intergenic
1163766082 19:19164235-19164257 TGGGATTACAGCCGTGAGCCCGG + Intronic
1164614161 19:29656138-29656160 GTGGGTGACAGCAGGGAGCCGGG + Intergenic
1164700551 19:30281244-30281266 CTGGAGTACAGCAGGGATGCAGG - Intronic
1164731509 19:30508489-30508511 GTGAATGACAGATGTGAGGCAGG + Intronic
1164858782 19:31545980-31546002 GTAGATTACATCTGAGAGGCTGG + Intergenic
1165821975 19:38682567-38682589 GAGGGTTCCAGCAGTGAGGCTGG - Intronic
1166171851 19:41033474-41033496 CTGCAAGACAGCAGTGAGGCTGG + Intergenic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1168509423 19:56962313-56962335 GTGGATGACAGCAGAATGGCTGG + Intergenic
927154585 2:20214099-20214121 CAGGATTACAACAGAGAGGCTGG + Intronic
927182008 2:20453397-20453419 ATGGATTAGAGCAGGGAAGCTGG + Intergenic
928196800 2:29222080-29222102 GTGGATAACAGCAGGGATACTGG + Intronic
928873415 2:36008726-36008748 GTGGGTAAGAGCAGAGAGGCTGG + Intergenic
932402180 2:71488662-71488684 CTTGATTAAAGCAGAGAGGCTGG - Intronic
934113214 2:88761445-88761467 ATGTATTACAGAAGTGAGGGAGG + Intergenic
934905496 2:98197824-98197846 GTGGATTTCAGGGCTGAGGCTGG - Intronic
936823537 2:116553195-116553217 CTGCAATGCAGCAGTGAGGCTGG + Intergenic
938981421 2:136530783-136530805 GGGGATTAGAGCAGTGATCCTGG + Intergenic
941411248 2:165159860-165159882 TGGGATTACAGGAGTGAGCCAGG - Intronic
941659358 2:168179793-168179815 GTGGAGGTCAGCAGGGAGGCTGG - Intronic
942076409 2:172360498-172360520 GGGGATTAGGGAAGTGAGGCAGG - Intergenic
945918395 2:215729150-215729172 GGGGATTACAGGTGTGAGCCTGG - Intergenic
946947118 2:224832672-224832694 GAGGATTGCAGCAGTGTGCCTGG - Intronic
947115064 2:226761025-226761047 GTGCATTTCAGCAGAGATGCAGG + Intronic
947825062 2:233100241-233100263 GTGGCCTACAGCAGTCAGGCGGG - Intronic
1168953608 20:1819110-1819132 GTGGATTTCAGAAGTGAGGTGGG + Intergenic
1171267531 20:23783949-23783971 GTTGATGACAGCAGTAATGCTGG - Intergenic
1173255010 20:41388013-41388035 GGGGATTACAGGCGTGAGCCTGG - Intergenic
1176269194 20:64226784-64226806 GTGGCTTACAGCAGAGAGTAAGG - Intronic
1178043812 21:28671582-28671604 CTGGATTACTGCAGTGTGGTAGG + Intergenic
1181682083 22:24502362-24502384 GTGCGTAACAGCAGGGAGGCCGG - Intronic
1183108571 22:35631693-35631715 GTGAATAAGAGCTGTGAGGCCGG + Intronic
1184096702 22:42319962-42319984 CTGGAGTAGAGCAGTGGGGCAGG - Intronic
949818778 3:8092434-8092456 GTGGATAGCAGAAGTAAGGCAGG + Intergenic
950565606 3:13768033-13768055 GTGGAGTGCAGCAGGCAGGCTGG - Intergenic
950570709 3:13798381-13798403 GTGGATTAAGGCATCGAGGCAGG - Intergenic
950644827 3:14370926-14370948 GGGGATTACAGCAGTGCTGCCGG - Intergenic
952468248 3:33614753-33614775 TGGGATTACAGGAGTGAGCCAGG + Intronic
952582952 3:34855912-34855934 GTGGATTAGAGCAAAGAGCCTGG + Intergenic
952860924 3:37811659-37811681 TTGGTTGACAGCAGTGAGGGAGG - Intronic
954291414 3:49651999-49652021 GTGGAGGACAGCAGTGAGGGTGG + Exonic
954789493 3:53120929-53120951 GTGGCTCACAGCAGTGCCGCTGG - Intronic
956621574 3:71226425-71226447 GTGGAGTTGAGCAGTGAGGCTGG - Intronic
957338173 3:78859074-78859096 GTGGACTACAGCAGGGAGACTGG + Intronic
959233000 3:103681318-103681340 CTGGATTCCATCAGTGAAGCCGG + Intergenic
960623927 3:119661915-119661937 GTGGATCACCTGAGTGAGGCTGG + Intronic
963913928 3:150840858-150840880 GTGAATGCCAGCAGGGAGGCAGG - Intergenic
964492333 3:157250091-157250113 GTGGATGAGAGTGGTGAGGCTGG - Intergenic
965910821 3:173773106-173773128 GTGGGTTATGGCAGTGGGGCTGG - Intronic
966484155 3:180448884-180448906 CTGGAAGGCAGCAGTGAGGCTGG + Intergenic
966618167 3:181934513-181934535 GTGGATGACAGCTGTGCAGCAGG + Intergenic
967733220 3:192925548-192925570 TGGGATTACAGGCGTGAGGCAGG + Intergenic
967842736 3:194019814-194019836 GGGGTTTTGAGCAGTGAGGCTGG - Intergenic
967986783 3:195101086-195101108 GTGGATTACAGCAGTGAGGCTGG - Intronic
968066976 3:195764167-195764189 GCGGAGAACAGCAGTGAGTCGGG + Intronic
969490875 4:7498641-7498663 GGGGCTTAGAGCAATGAGGCTGG - Intronic
969709982 4:8837175-8837197 GTGGATTGCACAAATGAGGCTGG + Intergenic
969991306 4:11266133-11266155 GGGGATCCCAGCAGTGAGGGGGG - Intergenic
972862034 4:43180920-43180942 GTTGATTACAGCAGGGAGTCAGG - Intergenic
973326752 4:48870300-48870322 CTGGAAGGCAGCAGTGAGGCTGG - Intergenic
975034269 4:69661349-69661371 GTGCAAGGCAGCAGTGAGGCTGG - Intergenic
977256047 4:94741149-94741171 GTGGAATACAGATGTGAGGTTGG - Intergenic
978681880 4:111390662-111390684 GTGGATTAGAACAGGGAGACAGG - Intergenic
979117865 4:116850256-116850278 GTGTTTTACTGTAGTGAGGCTGG + Intergenic
980102153 4:128552536-128552558 GAAAATTACAGCAGTGTGGCAGG - Intergenic
980889631 4:138800653-138800675 TTCGATTACAGCATTGATGCTGG + Intergenic
981966224 4:150607291-150607313 CTGGATTAAGGCAGTGAGGATGG + Intronic
984836411 4:184026139-184026161 CTGGAATACAGCAGTGAGCTTGG + Intergenic
986597396 5:9437976-9437998 TAGGATTAAAGCAGTGACGCAGG + Intronic
987195034 5:15517709-15517731 GTGGATTACAGGAGTTAAGGGGG + Intronic
988771922 5:34440885-34440907 GTGGATTGCAGCAGGGAGAGAGG - Intergenic
991022664 5:61996610-61996632 GAGGATTACAGCATGGAAGCAGG + Intergenic
991065003 5:62415430-62415452 TGGGATTACAGGAGTGAGCCCGG + Intronic
991502567 5:67291543-67291565 GTGGAAAACTGCAGTGAGGGTGG - Intergenic
992631166 5:78682365-78682387 CTGCATGGCAGCAGTGAGGCTGG + Intronic
995838942 5:116424902-116424924 TTGGAGTACAGAAGGGAGGCAGG - Intergenic
996045997 5:118873914-118873936 GTGAATGCCAGCAGGGAGGCAGG + Intronic
997208759 5:132065645-132065667 GTGGATTACAGCTCTCAGCCAGG + Intergenic
997551219 5:134754955-134754977 TGGGATTACAGGTGTGAGGCTGG - Intergenic
997950607 5:138239878-138239900 GTGTATTGCAGCTGTCAGGCTGG + Intergenic
999274083 5:150317332-150317354 CTGACTCACAGCAGTGAGGCAGG - Intronic
999317204 5:150591894-150591916 TGGGATTACAGGAGTGAGCCAGG - Intergenic
1001468761 5:171992942-171992964 ATGGATTACAGCAGTGATAAAGG + Intronic
1005496905 6:26395812-26395834 GTGAAGAACAGCAATGAGGCTGG + Intergenic
1007454324 6:41964677-41964699 GTGCATGACAGCAGGGTGGCAGG + Intronic
1008506599 6:52236943-52236965 GTGGATGACAGGGGTGACGCAGG + Exonic
1008588616 6:52970907-52970929 GTGGGTTCCAGCCCTGAGGCAGG + Intergenic
1010572032 6:77487446-77487468 GTTGCTTACTGCACTGAGGCAGG - Intergenic
1010702233 6:79064315-79064337 TTGGATAATAGCAGTTAGGCAGG - Intronic
1012463474 6:99490759-99490781 GTTGTTTACAGAAGTGGGGCAGG - Intronic
1014174993 6:118322505-118322527 GTGGACTGCTGCAGTGAAGCTGG - Intergenic
1014183484 6:118409097-118409119 GTGAATGACCGCAGGGAGGCAGG + Intergenic
1014659860 6:124156371-124156393 CAGGATTTCAGCAGTGAGGAAGG + Intronic
1014852779 6:126362009-126362031 GTGTATTAGAGCACTCAGGCTGG + Intergenic
1015069336 6:129071856-129071878 TGGGATTACAGGAGTGAGCCAGG - Intronic
1015891748 6:137976717-137976739 TAGGGTTACAGCAATGAGGCTGG - Intergenic
1021657107 7:22883177-22883199 TGGGATTACAGGAGTGAGCCTGG + Intergenic
1022114184 7:27248281-27248303 GTGGAGGACAGCAGGGAGGAAGG + Intergenic
1023380958 7:39607936-39607958 TGGGATTACAGGAGTGAGCCAGG + Intronic
1024331113 7:48156258-48156280 GTAGAGTTCAGCAGTGAGACAGG + Intergenic
1024475263 7:49802366-49802388 TGGGATTACAGGAGTGAGCCTGG - Intronic
1026871712 7:73856848-73856870 ATGGGATGCAGCAGTGAGGCAGG + Intergenic
1026979699 7:74519166-74519188 GTGGATTGGAGCAGAGGGGCAGG + Intronic
1028947152 7:96592970-96592992 GAGAATTACAGCAGAGAGGAGGG - Intronic
1033016944 7:137681009-137681031 CTGGACCACAGAAGTGAGGCAGG + Intronic
1033208848 7:139445349-139445371 TGGGATTACAGGCGTGAGGCTGG + Intergenic
1033368894 7:140691547-140691569 ATGGACTACAGCAGCCAGGCAGG - Intronic
1033741916 7:144282638-144282660 GTGGATGTCAGCAGTGGGGTGGG - Intergenic
1033751985 7:144366976-144366998 GTGGATGTCAGCAGTGGGGTGGG + Intronic
1034927069 7:155131013-155131035 GTGGGTGTCAGCAGTGAGGGTGG - Intergenic
1036064792 8:5367822-5367844 GTGGTTTCCAGGAGTGAGGGAGG + Intergenic
1036084558 8:5599551-5599573 TGGGATTCCAACAGTGAGGCAGG - Intergenic
1036221646 8:6926000-6926022 GAGGAGAACAGCAGTGAGGATGG + Exonic
1036704609 8:11037519-11037541 GAGAAATACAGCATTGAGGCTGG - Intronic
1039261501 8:35776837-35776859 TTGGATTACAGATGTGAGCCGGG - Intronic
1040546653 8:48403342-48403364 GTAGTTTACAGCAGGTAGGCAGG - Intergenic
1047758632 8:127937745-127937767 TAGGATTACAGGAGTGAGCCTGG + Intergenic
1047968851 8:130067695-130067717 TGGGATTAAAGCAGTGGGGCTGG - Intronic
1048137305 8:131758793-131758815 TGGGATTACAGGAGTGAGTCAGG + Intergenic
1048927220 8:139281881-139281903 GTGGACTGCAGGAGTGGGGCAGG - Intergenic
1049345292 8:142135643-142135665 GGGGAGTACAGCAGTGCTGCTGG - Intergenic
1050362884 9:4847539-4847561 GTGGAGTGGAGCAGGGAGGCAGG - Intronic
1058369743 9:104252021-104252043 GGGGATTCCAAAAGTGAGGCGGG - Intergenic
1061090387 9:128422724-128422746 GTGTGCTACAGCAGAGAGGCTGG - Intronic
1061837830 9:133341189-133341211 GGGGATCTCAGCAGTGGGGCAGG - Exonic
1062107350 9:134763213-134763235 GTGGGTTGAAGCAGTGAGCCAGG + Intronic
1062191770 9:135251512-135251534 GTGGGTGACAGCAGGGGGGCTGG + Intergenic
1186374914 X:8988596-8988618 CTGGCTTAGAGCAGTGAGGGTGG + Intergenic
1188087630 X:25920505-25920527 AAGAATTACATCAGTGAGGCTGG + Intergenic
1190525718 X:51327628-51327650 GAGGGTGACAGCAGTGAGGCAGG + Intergenic
1192256835 X:69468585-69468607 GTAGATAACAACAGTGAGGAGGG + Intergenic
1192273321 X:69605103-69605125 GTTGAATACAGGAATGAGGCTGG + Intergenic
1193072329 X:77319294-77319316 CTGCATGACAGCAGCGAGGCTGG + Intergenic
1193689408 X:84622455-84622477 GTGGAGTAAAGCACTGAGGCTGG + Intergenic
1193694179 X:84686670-84686692 GTGGAGGTCTGCAGTGAGGCTGG + Intergenic
1197363332 X:125533811-125533833 GTGGATTTCAGAAGAGAGGGTGG - Intergenic
1200106678 X:153717683-153717705 GGGGATTACAGGCGTGAGTCAGG + Intronic
1200467401 Y:3536311-3536333 GTGCAGTACAGCAATGGGGCTGG - Intergenic
1201764587 Y:17565708-17565730 GGGGATAAAAGCAGCGAGGCTGG - Intergenic
1201836966 Y:18340282-18340304 GGGGATAAAAGCAGCGAGGCTGG + Intergenic