ID: 967987916

View in Genome Browser
Species Human (GRCh38)
Location 3:195109058-195109080
Sequence CTCAGGAAAGTGAACTCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967987911_967987916 23 Left 967987911 3:195109012-195109034 CCCCAAAGGTATTATTATTTCCA 0: 1
1: 1
2: 0
3: 47
4: 820
Right 967987916 3:195109058-195109080 CTCAGGAAAGTGAACTCGAAAGG 0: 1
1: 0
2: 0
3: 16
4: 124
967987912_967987916 22 Left 967987912 3:195109013-195109035 CCCAAAGGTATTATTATTTCCAA 0: 1
1: 0
2: 1
3: 34
4: 404
Right 967987916 3:195109058-195109080 CTCAGGAAAGTGAACTCGAAAGG 0: 1
1: 0
2: 0
3: 16
4: 124
967987913_967987916 21 Left 967987913 3:195109014-195109036 CCAAAGGTATTATTATTTCCAAT 0: 1
1: 0
2: 1
3: 39
4: 395
Right 967987916 3:195109058-195109080 CTCAGGAAAGTGAACTCGAAAGG 0: 1
1: 0
2: 0
3: 16
4: 124
967987914_967987916 3 Left 967987914 3:195109032-195109054 CCAATATATTGATAAAGCAGTGA 0: 1
1: 0
2: 0
3: 25
4: 245
Right 967987916 3:195109058-195109080 CTCAGGAAAGTGAACTCGAAAGG 0: 1
1: 0
2: 0
3: 16
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967987916 Original CRISPR CTCAGGAAAGTGAACTCGAA AGG Intronic
900765081 1:4499591-4499613 CTGAGGAAATGGAACTTGAAAGG - Intergenic
904699334 1:32349130-32349152 CTCGGGGAAGTGAACTTCAAAGG - Intergenic
905482615 1:38271762-38271784 CTCAGGAAAGAGAACATGATTGG + Intergenic
905631479 1:39521438-39521460 CTGAAGAAAGTGACCACGAAAGG - Exonic
905666275 1:39764733-39764755 CTGAAGAAAGTGACCACGAAAGG + Exonic
907383666 1:54111464-54111486 CTCAGGAAGGTCAACTGGAGTGG + Intronic
909684244 1:78328714-78328736 ATCAGGAAAAAGAACTGGAAAGG - Intronic
914787348 1:150846363-150846385 CTCTGAAAAGTAAACTAGAAAGG + Intronic
915725860 1:158017103-158017125 CGCAGGAAAGGGAGCTCGCAGGG - Intronic
916324284 1:163540006-163540028 CTCAGAAAAATTAACTCAAATGG - Intergenic
916870157 1:168904928-168904950 CTCAGAAAACCAAACTCGAATGG - Intergenic
920540278 1:206773024-206773046 CTCTGGAAAGTAAAATGGAAGGG - Intergenic
924703807 1:246481528-246481550 CCCAGGAAAGTGGAGTCCAATGG - Intronic
1065382146 10:25101445-25101467 CTCAGGAAGTGGAACTCTAAAGG - Intergenic
1065789424 10:29246442-29246464 CTCAGGAAGCTGAAATGGAAGGG + Intergenic
1066036349 10:31491096-31491118 CTCAGGAAAGTGACCTCATAAGG - Intronic
1066239607 10:33520776-33520798 CAAAGGTAAGTGAACTCTAAGGG + Intergenic
1068202958 10:53807477-53807499 TTCAGGAAAGTTAAATTGAAAGG + Intronic
1069763827 10:70836569-70836591 CTCAGGAAAGGGAAAGGGAAAGG - Intronic
1070898914 10:80010587-80010609 CTCAGGAAAATGTAGTCGAATGG + Intergenic
1075645718 10:124094537-124094559 CTCAGGAAACTGAGGTCCAAGGG + Intergenic
1076747418 10:132521406-132521428 CTCAGGAAAGCGAGCTCCAGAGG - Intergenic
1080070724 11:28082855-28082877 CTCAGGAAAAAGAAATCGAAAGG - Exonic
1086090143 11:82997206-82997228 CTCAGGTAAGGGAACTCGTAAGG - Exonic
1086398430 11:86441083-86441105 TTCAGAAAAGTGAACTCCCAGGG + Intergenic
1087131674 11:94674108-94674130 CTCAGGAAGCTGTACTCCAAGGG + Intergenic
1088285030 11:108179067-108179089 CTCAGGAAAATGTAGTCGAATGG + Intronic
1093640322 12:21520110-21520132 CTAAGGAATGTGAAGTAGAAAGG - Intergenic
1094229968 12:28091798-28091820 GTGAGGAAAGAGAACTAGAATGG + Intergenic
1094801680 12:34044769-34044791 CTCATGAAAGTGAAGTAGGAAGG - Intergenic
1095114813 12:38340675-38340697 CTCAGGAAAGTGAAGTAGGAAGG - Intergenic
1100062231 12:90593331-90593353 TTCAGGAATGTCAACTCAAATGG + Intergenic
1103635718 12:122303550-122303572 CTCAGGAAAGAGATCACCAACGG - Intronic
1104265865 12:127231972-127231994 CTCAGGAAGGAGAGCTGGAAAGG - Intergenic
1105452798 13:20515703-20515725 CTCAGGTAAGTGGAATCGTAGGG - Intronic
1110021145 13:70475173-70475195 CACAGGAAAGTGAACTTAAATGG + Intergenic
1110239232 13:73248334-73248356 CTGAGGAAAGTGATCTGGGATGG + Intergenic
1111079321 13:83281094-83281116 CTAAGGAAAGTGAAATATAAAGG + Intergenic
1111774089 13:92637141-92637163 ATCTGGAAAGTGAATTGGAATGG - Intronic
1111843942 13:93485861-93485883 CTCAGGGAAGAGATCTGGAATGG + Intronic
1113896157 13:113765845-113765867 CTCAAGAAAGCAAACTAGAAAGG - Intronic
1118056576 14:62085389-62085411 GTCAGGAAGGTAAACTAGAAGGG + Intronic
1119643783 14:76334314-76334336 CTCTGGAGAGAGAACTCTAAGGG + Intronic
1120114502 14:80597914-80597936 CTCAGAAAAAGGAACTAGAAGGG + Intronic
1120673481 14:87391329-87391351 CTGAGGAAAGTGAAGTTAAACGG - Intergenic
1124714188 15:32043829-32043851 CTCAAGAAAGAGAAGTCTAAAGG - Intronic
1124858231 15:33411664-33411686 GTCAGGAAAATGAACTCCTAAGG - Intronic
1124967277 15:34444327-34444349 ATCTGGAAAGTGAATTGGAATGG - Intergenic
1126915683 15:53463756-53463778 CTCAGGAAGGTGAATTGGAAGGG - Intergenic
1128457159 15:67837926-67837948 CTCAGGAAAGTGAATTCAGAGGG - Intergenic
1129023733 15:72548907-72548929 CTCAGGACAGTTAACTCCAAAGG - Intronic
1130420806 15:83745206-83745228 ATCAGGAAAGGGAGCTGGAAAGG - Intronic
1131763522 15:95650604-95650626 CTCTGGGAACTGAACTCCAATGG + Intergenic
1134362690 16:13546276-13546298 CTGAGGAAAATGAAATGGAAGGG - Intergenic
1135203528 16:20461661-20461683 CACAAAAAAGTGAACTCAAATGG + Intronic
1135215476 16:20563275-20563297 CACAAAAAAGTGAACTCAAATGG - Intronic
1135503608 16:23017730-23017752 CACAGGAGAGTGGACTGGAAAGG + Intergenic
1136521625 16:30800337-30800359 CTCAGGAGAGGGAACGGGAAGGG + Intergenic
1139197204 16:64933388-64933410 CAAAGGAAACTGAACTGGAAAGG - Intergenic
1140114001 16:72026124-72026146 CTGAGGAAAGTGACCCCGCAGGG - Intronic
1141793040 16:86249555-86249577 CTCTGGAAGGTGAACTGGAAAGG + Intergenic
1142418216 16:89954552-89954574 CTCAGGAATGTGAATTCTAGTGG - Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1147678044 17:42220688-42220710 CTCAGGAAAGGGAGGCCGAAGGG + Intronic
1147688002 17:42298884-42298906 CTCAGGAAAGGGAGGCCGAAGGG - Intronic
1149638116 17:58186332-58186354 CTAAGGAAAGGGAACCCGCAGGG - Intergenic
1151672212 17:75577365-75577387 CTCTAGAAAGTGAACTGGAGGGG + Intergenic
1152444287 17:80331934-80331956 CTTAGGAAAGTGAAATAAAATGG + Intronic
1157126749 18:44963401-44963423 CTGGGGAAAGAGAACTTGAATGG + Intronic
1158441165 18:57475420-57475442 CTCAGAAAAGTGACCTGTAAAGG - Intronic
1159123358 18:64195513-64195535 CTCAGGAAAGTTAACTAACATGG - Intergenic
1162299101 19:9834305-9834327 CTCAGTGAAGTGAACTCATAGGG - Intergenic
1164161453 19:22627944-22627966 CCCAGGAAAGAGACCTCAAAAGG + Intergenic
1164975035 19:32566530-32566552 CTCAGGAAAATGAACAGTAAGGG + Intergenic
1167621476 19:50563317-50563339 CTCAGGAACTGGGACTCGAAGGG + Intronic
925103153 2:1266593-1266615 CTCAGGACAATGAACCCGCAAGG + Intronic
925234234 2:2264052-2264074 CTCAGGAAAGTTAACTTGCTGGG + Intronic
925483233 2:4300064-4300086 CTCCGGAAAGTGAATTCCACTGG - Intergenic
926862809 2:17326696-17326718 CTCAGGAAGTTGAACTTGGATGG - Intergenic
932654960 2:73602374-73602396 CACAGGAAAGTGAACGGGCAGGG - Intronic
932663100 2:73674002-73674024 CACAGGAAAGTGAACGGGCAGGG - Intergenic
942381172 2:175392669-175392691 CAGAGGAAAGTGAACAGGAATGG - Intergenic
942485644 2:176437107-176437129 TTCAGGAAATTGAACTTGAATGG - Intergenic
946001594 2:216486928-216486950 CTCAGGAAAGGGAACTAAAAAGG - Intergenic
1170194102 20:13673218-13673240 CCCAGAAAAATGAACTCAAATGG + Intergenic
1171143758 20:22764509-22764531 GTCAGGAAAGTGAACCCGAGTGG - Intergenic
1178166478 21:29983746-29983768 CTCAGAAAACTGAACTCTCATGG + Intergenic
1178614973 21:34124661-34124683 CTAAGGAAAGTTTACTTGAAAGG - Intronic
1182634615 22:31715259-31715281 CACAGGAAAGGGAACTTGATGGG - Exonic
951926235 3:27911673-27911695 CTCAGAAAGGTGAACTTGGAAGG - Intergenic
955953285 3:64263510-64263532 CTGTGGAAAGTGAACTCAAAGGG - Intronic
957170036 3:76726492-76726514 CTCAGAAAAGTGAAGACAAAAGG - Intronic
960182379 3:114595766-114595788 ATCAGGAATATGAACTCTAAAGG - Intronic
963940564 3:151092268-151092290 CTCAGGGAAATGAACTGGCAAGG - Intronic
967091355 3:186137464-186137486 CTCAGGAAAGAGAATGAGAATGG + Intronic
967987916 3:195109058-195109080 CTCAGGAAAGTGAACTCGAAAGG + Intronic
972656237 4:41066456-41066478 CTAAGGAAAGTGAAGTCTAGGGG + Intronic
972816447 4:42651766-42651788 CTCAGGACAGTGAAGCAGAAAGG + Intronic
973150879 4:46886988-46887010 CTCAGCAAAGTGAAATATAAAGG + Intronic
975790769 4:77947622-77947644 CTCAGGAAAGCAAACTTGCAAGG - Intronic
979859799 4:125679440-125679462 ATCTGGAAACTGAACTTGAAAGG + Intergenic
981857829 4:149315616-149315638 CTCAGGAAACTTAACACTAATGG + Intergenic
984126900 4:175822070-175822092 CTCAGAAATGTGTACTAGAAGGG - Intronic
985396473 4:189549875-189549897 CTGAGGAAATTGAATTCAAAGGG + Intergenic
994348990 5:98722707-98722729 CTTAGGAAAGTCAATTCTAATGG - Intergenic
995462199 5:112415641-112415663 CTCAGCACAGAGAACTAGAAAGG + Intronic
996903386 5:128570238-128570260 CTCAGGAAAGTAAAGTCATATGG + Intronic
1000282924 5:159797840-159797862 CTCAGCAAAGGGAGCCCGAATGG + Intergenic
1009902207 6:69821280-69821302 CTCAGGAAAGTGACCTCATTTGG + Intergenic
1010747935 6:79585556-79585578 GTCAGGAAACTGAACTGCAAGGG - Intergenic
1014671039 6:124304117-124304139 CTCAGGAAAGTAATATTGAATGG + Intronic
1014961336 6:127689126-127689148 TTCAGGAAAGTAAACTTAAAGGG - Intergenic
1017874886 6:158516269-158516291 CTCAGGGGAGGGAACACGAAAGG + Intergenic
1021048032 7:15946831-15946853 CTCAGGAAATAGAACTAGCAGGG - Intergenic
1022918947 7:34992983-34993005 CTCAGGAACACGAACTCCAAAGG - Intronic
1028400109 7:90416352-90416374 CTCAGAAAAAGGAACTAGAAAGG + Intronic
1032962934 7:137060661-137060683 CTCAGGAAAGTTAACTATCATGG - Intergenic
1033144586 7:138860554-138860576 CTCAGGAAGGTAAATTTGAAAGG + Intronic
1035925850 8:3726740-3726762 CTCAGGAATGAGAACTGGACTGG - Intronic
1039648235 8:39310891-39310913 TTCAGGAAAGTGAACCTGCATGG - Intergenic
1042516361 8:69663180-69663202 TCCAGGAAAGTGAACACAAAAGG - Intergenic
1043373574 8:79621845-79621867 CTCAGGAAGGTGGACTCAGAGGG - Intronic
1043868095 8:85398670-85398692 CACAGGGAAGAGAACTAGAAAGG - Intronic
1045584645 8:103519484-103519506 CTGAGAAATGTGAACTGGAAGGG - Intronic
1047306534 8:123657479-123657501 CACAGGAAGGTGATCTAGAAGGG - Intergenic
1056660954 9:88542902-88542924 CTCAGGATTGTGAACCCGAGTGG - Intronic
1057580036 9:96279583-96279605 ATCAGGAAAATGACCTGGAAAGG + Intronic
1059632178 9:116136434-116136456 CTCAGGAGAGTGAATTGGAAAGG + Intergenic
1187564000 X:20430333-20430355 CCCAGGAAAGGGATCTCCAAAGG + Intergenic
1187764993 X:22631787-22631809 GCCAGGAAAGCAAACTCGAAAGG - Intergenic
1192615439 X:72616258-72616280 CTCAGGAAACTGAAGTTGGAGGG + Intronic
1192767368 X:74155601-74155623 GTCAGAAAAGTGAAATCAAAGGG + Intergenic
1192814367 X:74575697-74575719 CTCAGGAAAGTTAACTCCTGGGG - Intergenic
1194792795 X:98171722-98171744 CACAGGAAAGGGAAATCAAATGG - Intergenic
1194893518 X:99409758-99409780 CTCAAGTAAGTGAAATCGTACGG - Intergenic
1195868100 X:109455439-109455461 CTCAGGTAGGTGAACTTGACAGG - Intronic
1196812353 X:119638765-119638787 CTCTGGACAGTGATCTCTAATGG + Intronic
1199879241 X:151959963-151959985 CTCAGGATAGGAAACTGGAAAGG + Exonic
1201208158 Y:11652558-11652580 CTGAGTGAAATGAACTCGAATGG + Intergenic
1202183064 Y:22156080-22156102 CTGAGGTAAGAGTACTCGAATGG - Intergenic
1202208295 Y:22430321-22430343 CTGAGGTAAGAGTACTCGAATGG + Intergenic