ID: 967989961

View in Genome Browser
Species Human (GRCh38)
Location 3:195123351-195123373
Sequence TTCCGTCAGCCGGCCAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967989961_967989967 26 Left 967989961 3:195123351-195123373 CCTCTCCTGGCCGGCTGACGGAA 0: 1
1: 0
2: 0
3: 8
4: 88
Right 967989967 3:195123400-195123422 CTTCCCTCTCCTGACTGATGAGG 0: 1
1: 0
2: 0
3: 24
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967989961 Original CRISPR TTCCGTCAGCCGGCCAGGAG AGG (reversed) Intronic
902154621 1:14474755-14474777 TTCAGTCATCCAGCCAAGAGTGG + Intergenic
903593408 1:24474718-24474740 TTCAGTCTACCGGCCAGGTGCGG + Intergenic
904646222 1:31968738-31968760 TTCTTTCAACAGGCCAGGAGCGG - Intergenic
905132265 1:35769917-35769939 TTCCCTCAGCCGGAGAGCAGCGG + Exonic
906640722 1:47439043-47439065 TACCGACAGCTGGCAAGGAGCGG - Exonic
916166805 1:161972405-161972427 TTCAGTCAGGCGGTGAGGAGCGG - Intergenic
921306868 1:213806040-213806062 TTCAGTCAACCGGCCAGGCATGG + Intergenic
1069867318 10:71511843-71511865 TGCCATCAGCCACCCAGGAGAGG - Intronic
1077228600 11:1448907-1448929 CACCGCCAGCCGGCCACGAGGGG - Intronic
1083845715 11:65332083-65332105 TTACATCAGCTGGCCAGGCGTGG + Intergenic
1088644248 11:111904045-111904067 TTCGGTCAGCAGGCCAAGTGTGG + Intergenic
1091204734 11:133812354-133812376 CTCAGGGAGCCGGCCAGGAGAGG + Intergenic
1091980658 12:4861291-4861313 CTCCGTCAGCAGGCAAGGAAGGG + Intergenic
1097673320 12:62568371-62568393 TTCTGTCACCCAGGCAGGAGTGG + Intronic
1101827952 12:108235402-108235424 TTCCATCAGACTGTCAGGAGCGG + Intronic
1102979540 12:117230540-117230562 TTTCTTCTGCCGTCCAGGAGAGG - Intronic
1112366557 13:98760719-98760741 TTTGGTGAGCCAGCCAGGAGTGG + Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1114616718 14:24072372-24072394 TTCCATCAGCTAGCCAGAAGGGG + Intronic
1122787610 14:104171197-104171219 TTCCCTCAGCTGGCCAGGGTCGG + Intronic
1122793780 14:104195519-104195541 TGAGGTCAGCCGGCCAGGACAGG - Intergenic
1123035796 14:105471415-105471437 CTACCTCAGCCGGCCAGGAGGGG + Intergenic
1127748789 15:62009895-62009917 TTCCATCAACAGGCCAGGCGCGG + Intronic
1128109314 15:65066915-65066937 CTCCTTCAGCCAGCCAGGAGTGG + Intronic
1129325442 15:74798076-74798098 TACCGTCAGCCTGCCAGGACTGG + Intronic
1129538644 15:76334026-76334048 TTCAGACAGCTGGCCAGGAGGGG - Intergenic
1130907774 15:88252347-88252369 ATCCTTCAGCCAGCCAGAAGAGG + Intronic
1132927100 16:2436530-2436552 TTCTGCCAGCCGGCCAGGTAGGG - Intronic
1132999856 16:2843780-2843802 TGCAGTCAGCCGCCCAGGTGAGG + Intergenic
1136039416 16:27566246-27566268 TTCAGGAAGCCGGCCAGGCGTGG + Intronic
1137729240 16:50677621-50677643 TTCCCTCTGCCTGCCAGGAGGGG - Intronic
1144826533 17:18108517-18108539 TTCTGTGAGGCTGCCAGGAGGGG + Intergenic
1146187547 17:30734416-30734438 TGTAGTCAGCCGGCCAGGCGCGG - Intergenic
1147235953 17:39057566-39057588 GTCCTTCAGCGGGCCAGGCGCGG - Intergenic
1152587317 17:81194834-81194856 TCCCATGAGCCGGCCAGGTGTGG - Intronic
1154323664 18:13374689-13374711 TTCTGCCACCCAGCCAGGAGTGG + Intronic
1159588509 18:70305945-70305967 TTTTGTCAGCTGGCCAGGCGTGG + Intronic
1162775359 19:12975665-12975687 GCCCGCCAGCCGGCCAGGCGGGG + Intergenic
1164869028 19:31628007-31628029 TCCCGTCGGCCGGCGAGGAGGGG - Intergenic
1165087514 19:33361357-33361379 CTCAGTCACCCGGCCTGGAGGGG + Intergenic
1165830337 19:38727513-38727535 GTCCGTCAGCCCGGCAGGGGTGG - Intronic
925001490 2:406526-406548 TACAGTCAGATGGCCAGGAGAGG - Intergenic
927251704 2:21000486-21000508 TTCACTCAGCCTGCCAGGAGTGG - Intergenic
927698110 2:25251417-25251439 TTCCGTGAGCCAGCAGGGAGTGG - Intronic
928956885 2:36878528-36878550 TTACCTCTGCCGGCCAGAAGAGG + Intronic
944206815 2:197165163-197165185 TTCAGCCAGCCAGCCAGAAGGGG - Intronic
947736307 2:232457255-232457277 CTGCCTCAGCCCGCCAGGAGGGG + Exonic
948671091 2:239569423-239569445 TGACGTCAGGCAGCCAGGAGAGG - Intergenic
1168913159 20:1466436-1466458 CTGCGGCAGCCGGCGAGGAGAGG - Intronic
1169913647 20:10667138-10667160 GTCCGTCAGCTTGGCAGGAGGGG - Intronic
1170554785 20:17506160-17506182 TGCCGGCTGCTGGCCAGGAGTGG - Intronic
1170744379 20:19086074-19086096 GTCAGTCAGTAGGCCAGGAGTGG + Intergenic
1172697197 20:36831087-36831109 TTCCCTCAACCAGCCAGCAGGGG - Intronic
1172897056 20:38307558-38307580 TCCCTTCAGCCAGCCAGCAGGGG + Exonic
1175381844 20:58569005-58569027 TTCCTTCTGCCACCCAGGAGAGG + Intergenic
1175726697 20:61323330-61323352 GTTCATCAGCCTGCCAGGAGGGG + Intronic
1179808755 21:43856723-43856745 TTCACTGAGCCGGCCAGGTGCGG - Intergenic
1183150130 22:36030336-36030358 TGCCTTCAGTCGGCCAGGCGCGG - Intergenic
1183462585 22:37961137-37961159 TTGCTTGAGCCGGCCAGGCGCGG - Intronic
1183740236 22:39664931-39664953 TTCCCCCATCCGCCCAGGAGGGG - Intronic
950042467 3:9929022-9929044 TTCACTCATCCGGCCAGGCGCGG + Intronic
950066463 3:10115816-10115838 TTCGGTCAGCGGGCCAGCAAGGG + Exonic
952954853 3:38550568-38550590 TTCCGTCAGCAGGCGGGCAGCGG - Exonic
962878344 3:139553215-139553237 TGCCATCAGCAGGCCAGAAGTGG - Intergenic
964841585 3:160999438-160999460 TTCCCTCTGGCGGCCAGGTGGGG - Intronic
966988479 3:185204096-185204118 TTCTGTCACCCAGGCAGGAGTGG - Intronic
967989961 3:195123351-195123373 TTCCGTCAGCCGGCCAGGAGAGG - Intronic
968219515 3:196925908-196925930 TTCAGTCATCTGGCCAGGTGGGG + Intronic
979351776 4:119651673-119651695 TTCCCTCAACAGGCCAGGTGCGG - Intergenic
997359908 5:133288430-133288452 TTCAGTGAGCGGGCCAGGAGTGG - Intronic
1002278205 5:178116386-178116408 TCCAGTCAGTCAGCCAGGAGGGG + Intronic
1006847429 6:37072313-37072335 TGCCATCAGCAGGCCAGGTGCGG + Intergenic
1007320876 6:41028150-41028172 CGCCCTCTGCCGGCCAGGAGGGG + Exonic
1011464815 6:87644381-87644403 TACAGTCAGCCGGCCGGGCGCGG - Intronic
1011494627 6:87925956-87925978 GTCACTCAGCTGGCCAGGAGTGG + Intergenic
1014027689 6:116668657-116668679 CTCAGTCATCAGGCCAGGAGAGG - Exonic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1023025980 7:36049833-36049855 CTCCTTCAGCAGGCCTGGAGGGG + Intergenic
1026184527 7:68072116-68072138 TTCTGTCAGCCAGACTGGAGTGG + Intergenic
1029125870 7:98294985-98295007 GTCAGGCAGCCGCCCAGGAGAGG + Intronic
1029354953 7:100044914-100044936 TGCCATCAGCTGGCCAGCAGAGG - Intergenic
1029672078 7:102040265-102040287 TTCCGTCATCCTCCCTGGAGAGG - Intronic
1030050355 7:105532090-105532112 TTCCGACCTCCGGTCAGGAGGGG + Exonic
1033732834 7:144195647-144195669 TCCCGTCGGGCGGCCAGGGGCGG - Exonic
1033743684 7:144294227-144294249 TCCCGTCGGGCGGCCAGGGGCGG - Intergenic
1033750217 7:144355370-144355392 TCCCGTCGGGCGGCCAGGGGCGG + Exonic
1037250724 8:16890894-16890916 TTCTATCAGCTGGCCAGGTGTGG - Intergenic
1038779098 8:30555910-30555932 TTCGGGCAGCCGGCCCGGTGGGG - Intronic
1041028058 8:53707234-53707256 TTCCATGAACTGGCCAGGAGGGG - Intergenic
1041317706 8:56581751-56581773 TTTTGTCAACAGGCCAGGAGAGG + Intergenic
1044081654 8:87892796-87892818 TTCCAGCCACCGGCCAGGAGCGG + Intergenic
1049465200 8:142748104-142748126 CTCCATCAGCCCGCCAGGGGTGG + Intergenic
1057758538 9:97854807-97854829 TCCCGCCAGGCGGCCAGCAGCGG - Exonic
1061508167 9:131044219-131044241 GTGCGTGAGCCGGCCAGGCGCGG + Intronic
1062015256 9:134288005-134288027 CTCCGTCAGCCTGCCCGGATGGG - Intergenic
1187299013 X:18030064-18030086 TTGCTCCAGCCAGCCAGGAGAGG + Intergenic
1196691032 X:118558261-118558283 TTCACACAGGCGGCCAGGAGCGG - Intronic