ID: 967998865

View in Genome Browser
Species Human (GRCh38)
Location 3:195187385-195187407
Sequence ACACAGAAGAGACAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 389}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967998865 Original CRISPR ACACAGAAGAGACAGTTGGG AGG (reversed) Intronic
901457676 1:9372678-9372700 ACAGAGCAGAGAGAGCTGGGAGG - Intergenic
902121989 1:14174129-14174151 ACACTGAATAGACAAATGGGTGG + Intergenic
902125636 1:14208523-14208545 TCACAGAGTTGACAGTTGGGTGG + Intergenic
902126715 1:14220066-14220088 ACACCAAAGGGACAGTTGGAAGG - Intergenic
902258847 1:15208659-15208681 AGACAAAAGAGACAGGTGGAAGG + Intronic
903000610 1:20262933-20262955 ATACCCAAGAGACAGTGGGGAGG - Intergenic
906675603 1:47691361-47691383 ACACACAAGGGCCTGTTGGGTGG - Intergenic
906795712 1:48695003-48695025 ACAGAAAAGAGCCAGTAGGGTGG - Intronic
908013487 1:59807685-59807707 ACTCAGGAGAGAGAGGTGGGGGG + Intergenic
909480090 1:76121385-76121407 ACAGAGAACAGACAGTGGGGAGG - Intronic
909985000 1:82150681-82150703 ACAAAGAAGAGAAATTTGAGAGG - Intergenic
910009824 1:82447844-82447866 ACACAGAAGAAAAATTTGAGTGG + Intergenic
910093081 1:83488378-83488400 ACAGAGAAGAGAGAATTGGCAGG - Intergenic
910135242 1:83960552-83960574 AGACAGAAGAGCCAGTTTGAGGG + Intronic
910907962 1:92201600-92201622 ACAAAGAAGAAATAGGTGGGAGG - Intergenic
911926505 1:103838764-103838786 ACACAGCACAGCCTGTTGGGGGG + Intergenic
912991889 1:114495686-114495708 ACAGAGAAGAGAAAATTGGATGG + Intronic
914689945 1:150016907-150016929 AGACAGGGGAGACAGTTGGGTGG - Intergenic
915222335 1:154385004-154385026 ACAGGGAAGAGACAGGTGGAGGG + Intergenic
915972484 1:160364471-160364493 GCAGAGAGCAGACAGTTGGGAGG - Intergenic
916059190 1:161087177-161087199 ACACAGAAGAGCCAGAATGGGGG + Intronic
916595598 1:166239733-166239755 ACACACCAGGGACAGTTGTGGGG - Intergenic
917139175 1:171817690-171817712 ACACAGGAGAGATATTTGAGGGG + Intergenic
917285718 1:173419608-173419630 TCACAGAAGAGAGAGGAGGGTGG + Intergenic
918959780 1:191258961-191258983 ACACAGCAGGGACTGTTGTGGGG + Intergenic
919117295 1:193296502-193296524 ACACTGGAGAGACAGATAGGTGG + Intergenic
919204638 1:194406249-194406271 ACACACCAGAGACTGTTGGGGGG + Intergenic
919728742 1:200899951-200899973 AGACAGGAGAGACAGTGTGGAGG + Intronic
920437518 1:205957010-205957032 ACACAGAACACATATTTGGGAGG - Intergenic
921448931 1:215279759-215279781 ACACTGAAGAGATGGGTGGGTGG - Intergenic
922562253 1:226577849-226577871 GCACAGAGGAGACAGTAGGGCGG + Intronic
923252914 1:232193697-232193719 TCACAGAAGAGAAAGATTGGAGG - Intergenic
924778632 1:247128358-247128380 ACCCAGAAAAGACAGGAGGGTGG - Intronic
924783022 1:247170061-247170083 ACCCAGAAAAGACAGGAGGGTGG + Intronic
1062962093 10:1580070-1580092 ACACAGCATAGACAATTCGGGGG - Intronic
1065421343 10:25547647-25547669 ACACAGCAGAGCCAGTTAGGAGG + Intronic
1065668466 10:28087794-28087816 GCACAGAAGGGACAGTGAGGTGG + Intronic
1066934283 10:41805961-41805983 ACACACTGGAGACAGTTGTGGGG + Intergenic
1067107632 10:43376448-43376470 AGCCATAGGAGACAGTTGGGCGG - Intergenic
1067969703 10:50955500-50955522 GCACAGAAGAGACATTAAGGTGG - Intergenic
1068277799 10:54825032-54825054 ACACACAGGAGACTGTTGTGGGG - Intronic
1069188368 10:65456701-65456723 ACACACCAGGGACAGTTGTGTGG + Intergenic
1069948074 10:72001022-72001044 AGCCAGATGAGACAGCTGGGAGG + Intronic
1070495627 10:77019121-77019143 ACAGAGAAGATACATTTGTGAGG + Intronic
1070586529 10:77770946-77770968 CCACAGAAGAGACAGGTCTGTGG - Intergenic
1071848757 10:89547015-89547037 ACACACCAGAGCCTGTTGGGGGG + Intronic
1072383661 10:94901150-94901172 ACACACCAGAGACTGTTGTGTGG + Intergenic
1072909573 10:99487889-99487911 TCCCTGAAGAGACAGTGGGGTGG - Intergenic
1074108248 10:110404529-110404551 CCACAGAGGTGACAGTAGGGAGG + Intergenic
1074259131 10:111834257-111834279 TCACAGATGAGCCAGTTTGGTGG + Intergenic
1074442453 10:113490451-113490473 AGACAGAAGAGCCAGTCTGGAGG + Intergenic
1074753361 10:116607643-116607665 ACACAGAAGAGAAAGTGGGAAGG + Intronic
1076225935 10:128775400-128775422 GCACAGAAGCGACTGTTGAGTGG - Intergenic
1077935508 11:6781615-6781637 AAACAGATCAGACAGTTGGCAGG + Intergenic
1078284789 11:9941204-9941226 ACACAGGAGAGTGAGGTGGGAGG + Intronic
1078747697 11:14131162-14131184 ATACAGAAGAGACGATTGGATGG - Intronic
1079206281 11:18417500-18417522 ACACAGAAGGGTGAGGTGGGAGG - Intronic
1081339647 11:41912237-41912259 ACAAACAAGAGCCAGTTGAGGGG - Intergenic
1082578361 11:54837126-54837148 ACACACCAGGGACAGTTGTGGGG + Intergenic
1083884994 11:65568908-65568930 AGGCAGAATAGACAGTTGAGTGG + Intergenic
1084002110 11:66301677-66301699 AAAAAGAAGAGACAGCCGGGCGG - Intergenic
1084107186 11:66987752-66987774 ACAGACAAGAGACAGTTGGAAGG + Intergenic
1085626373 11:78076844-78076866 ACAAAGGAGATACAGTTGGGAGG - Intronic
1086152488 11:83627372-83627394 ACACACCAGAGACTGTTGTGGGG - Intronic
1086373239 11:86175320-86175342 ACACCTTAGAGACATTTGGGAGG - Intergenic
1086448306 11:86890818-86890840 ACACAGAAGAGAAAGTCCAGTGG - Intronic
1086749666 11:90475821-90475843 ATACAGAATATACAGTTTGGTGG - Intergenic
1086972255 11:93095522-93095544 ACACAGCAGAGACAGTGAGAAGG - Intergenic
1087326674 11:96732335-96732357 ACAAAGAATAGAAAGGTGGGAGG - Intergenic
1087601981 11:100328558-100328580 AGAAGGAAGAGACAGGTGGGAGG + Intronic
1089247970 11:117136485-117136507 ACACAGCAGAAACAGGTGGAAGG - Intergenic
1089258744 11:117208076-117208098 ACACAGCAGAAACAGGTGGAAGG + Intronic
1089267169 11:117272418-117272440 ACACACCAGGGTCAGTTGGGGGG + Intronic
1089533625 11:119148165-119148187 ACACAGCAGAGACGATGGGGAGG - Intergenic
1089787419 11:120917951-120917973 AAGCAGAAGAGACAGGTGGTAGG + Intronic
1090407562 11:126486272-126486294 GCAGAGAAGGGACAGTGGGGTGG + Intronic
1092006183 12:5072390-5072412 ACACAGAGGTGACAGTAAGGCGG - Intergenic
1092439313 12:8483818-8483840 ACACTGAAGAGAGCGTTGGGAGG - Intergenic
1093384522 12:18535688-18535710 ACACAGCATAGAGAGTAGGGTGG + Intronic
1094533168 12:31296744-31296766 ACTCAGGAGAGAGAGGTGGGAGG + Intronic
1095137454 12:38622912-38622934 ACACACAAGGGACTGTTGTGGGG + Intergenic
1095237046 12:39809665-39809687 ACACACCAGAGACTGTTGTGGGG - Intronic
1095732883 12:45523971-45523993 ACACAGCAGGGACTGTTGTGGGG + Intergenic
1095853968 12:46840651-46840673 AAACAGAAGAGTAAGTTGGATGG + Intergenic
1097170777 12:57111420-57111442 ACAGAGAAGAGAAAGTGGGCTGG + Exonic
1097523996 12:60707393-60707415 ACACAGCAGGGCCTGTTGGGTGG - Intergenic
1097819713 12:64116146-64116168 ACTCAGAAGGGTGAGTTGGGAGG + Intronic
1098475576 12:70897984-70898006 ACACACCAGAGACTGTTGTGGGG + Intronic
1100224637 12:92543685-92543707 GCACAGAAGAGGGGGTTGGGGGG + Intergenic
1101115648 12:101529053-101529075 AAACACAAGAGACATTTTGGAGG - Intergenic
1101440257 12:104698662-104698684 ACAGATAACAGACAGTTGAGTGG - Intronic
1102595637 12:113990713-113990735 GCACATAAGAGAGAGGTGGGAGG - Intergenic
1102839413 12:116102324-116102346 TCCCAGATGAGACAGTTGGGAGG + Intronic
1102879542 12:116474029-116474051 ACACACAAGAGACACCTGGGTGG + Intergenic
1102980544 12:117237543-117237565 ACACAGAGGGGACACTCGGGGGG - Intronic
1103568769 12:121830529-121830551 ACAGAGAAGAGAGAGAGGGGAGG - Exonic
1104020374 12:124988352-124988374 AAACAGAAGAGGCCATTGGGTGG - Intronic
1104758877 12:131285425-131285447 AGAGAGAGGAGAAAGTTGGGGGG - Intergenic
1104790296 12:131477189-131477211 ATATAGAAAAGACATTTGGGAGG + Intergenic
1104920950 12:132290433-132290455 ACAGAGAACAGCCTGTTGGGTGG - Intronic
1105450756 13:20497167-20497189 AGACACAAGAGGCCGTTGGGGGG + Intronic
1105821753 13:24086640-24086662 CCACAGAAGACACAGTTCAGAGG + Intronic
1106130893 13:26938589-26938611 ACACACCAGGGCCAGTTGGGGGG - Intergenic
1106573096 13:30947898-30947920 ACACACCAGGGACAGTTGTGGGG - Intronic
1106765688 13:32911511-32911533 CCACAGACCAGACAGTTAGGAGG - Intergenic
1107404023 13:40096188-40096210 ACATAAAAGAGAGAGTTGTGGGG + Intergenic
1107447561 13:40482209-40482231 AGAGACAAGAGACAGTAGGGGGG + Intergenic
1111362229 13:87190607-87190629 AGACTGAGGGGACAGTTGGGAGG + Intergenic
1111550988 13:89812219-89812241 AGAAAGAAGAGAAAGTGGGGAGG + Intergenic
1112191238 13:97179830-97179852 CCACAGTAGAGAGAGTTAGGGGG + Intergenic
1112328875 13:98462081-98462103 ACAGAGAAGAGACCATCGGGAGG + Intronic
1112801655 13:103117952-103117974 ACACAGCAGGGACAGTTGTGGGG - Intergenic
1114388109 14:22276780-22276802 ACACAAAAGGGAAATTTGGGTGG - Intergenic
1114807221 14:25852098-25852120 ACACACCAGAGACTGTTGTGGGG - Intergenic
1115357724 14:32466557-32466579 ACACACCAGAGCCTGTTGGGGGG + Intronic
1116186678 14:41607416-41607438 ACACAGAAGGGCCAGCAGGGAGG - Intergenic
1116645075 14:47517003-47517025 AAACAGAAGAAACAATTGGAAGG + Intronic
1117034464 14:51713775-51713797 ACAAAAAAGAGCCAGTTAGGAGG - Intronic
1117726639 14:58681286-58681308 AAACTAAAGAGACAGTTGTGGGG - Intergenic
1118966570 14:70592453-70592475 ACATAGGAGAGACAGTGGTGTGG - Intronic
1120604910 14:86562763-86562785 ACACACCAGAGCCTGTTGGGGGG - Intergenic
1121795885 14:96735218-96735240 TCAAAGAAGAGACAGATGTGCGG + Intergenic
1122149597 14:99717796-99717818 ACACAGCAGGGAGAGTGGGGGGG - Intronic
1123452490 15:20378715-20378737 ACACACAAGATACAAATGGGTGG + Intergenic
1123540511 15:21285174-21285196 AGACAGAAGAGAAAGGTGAGGGG + Intergenic
1123881870 15:24684341-24684363 AGAAAGAAGGGTCAGTTGGGTGG + Intergenic
1125463690 15:39930301-39930323 ACATAGAAGAGCCAGGTGGAGGG - Intergenic
1126470103 15:49000626-49000648 CAACAGAAGGGACAGTTGGTGGG + Intronic
1126675205 15:51154997-51155019 GCACAGAGGAGACAGCTGAGGGG + Intergenic
1127687175 15:61359314-61359336 ACACACCAGAGACTGTTGGGAGG - Intergenic
1127912946 15:63433380-63433402 ACAGAGAAGAGGCAGATGAGGGG - Intergenic
1128406939 15:67351249-67351271 ACACACCAGGGACTGTTGGGGGG - Intronic
1129113079 15:73349576-73349598 GCACAGGAGAGAGAGCTGGGAGG - Intronic
1129263662 15:74382652-74382674 ACACAGAAGGCATAGGTGGGAGG + Intergenic
1130766364 15:86875484-86875506 ACACTGAAGAGAAAGTTATGAGG - Intronic
1132209193 15:100007888-100007910 ACACAGAGAAGACAGCTTGGAGG + Intronic
1202948825 15_KI270727v1_random:12316-12338 AGACAGAAGAGAAAGGTGAGGGG + Intergenic
1132742801 16:1423812-1423834 CCACAGAAGAGACTGTCGTGTGG - Intergenic
1133080292 16:3313402-3313424 ACACAGAAGAGGAAGTTTGGTGG - Intronic
1134342551 16:13358391-13358413 ACACAGCACAGCCTGTTGGGGGG - Intergenic
1134535579 16:15024332-15024354 ATACAAAGGAGACTGTTGGGAGG - Intronic
1136034070 16:27525454-27525476 ACAAAGAAGGAACAGCTGGGAGG - Intronic
1137064452 16:35825513-35825535 ACACAGCAGAGCCTGTTGTGGGG - Intergenic
1137308471 16:47229640-47229662 AGAGAGAAGGGACAGTTGTGGGG + Intronic
1138066307 16:53944993-53945015 ACACAGAATTGACAGGTGGAGGG + Intronic
1139055514 16:63178978-63179000 AAAAAGAAGAGACAGTAGAGGGG + Intergenic
1140153944 16:72402761-72402783 ACACATCAGAGAGAGTTGGAAGG - Intergenic
1141195632 16:81858745-81858767 ACACTGAAGAGACAGTCTTGAGG - Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1142402008 16:89863836-89863858 TTGCAGAAGAGACAGCTGGGCGG - Exonic
1142768820 17:2081981-2082003 ACAAAGAGGAGACAGTTAGCTGG + Intronic
1142799322 17:2335702-2335724 GCAGAGAAGAGACAGCTGGGTGG - Exonic
1142973810 17:3631123-3631145 ACAAAGAAGAGAAAGAAGGGAGG + Intronic
1143334633 17:6163097-6163119 ACACAGCTGGGACAGGTGGGAGG - Intergenic
1143393863 17:6576513-6576535 CCACAGAAGTGACCTTTGGGAGG - Intergenic
1144318305 17:14086012-14086034 ACACAGAAGAGAAGGCTGGGAGG - Intronic
1144595264 17:16564519-16564541 ACACAGATGACACAGTTGAATGG + Intronic
1145233174 17:21189823-21189845 ACACAGAACAGACATTGGTGAGG + Intronic
1146032219 17:29376087-29376109 ACCCAAAAGACAAAGTTGGGGGG + Intergenic
1147508416 17:41043973-41043995 ACACAGAAGTCACTGTTGGTTGG - Intergenic
1148894184 17:50830601-50830623 TCACAGAAGAGGCAGCTGGAAGG + Intergenic
1149980527 17:61307512-61307534 ACACAGAAGACACAGTTTAAAGG - Intronic
1151546589 17:74797039-74797061 CCACAGCAGAGCCAGTTTGGTGG + Intronic
1153024151 18:658148-658170 ACACAGCAGCGACAGCCGGGAGG + Exonic
1153359246 18:4174769-4174791 ACACACCAGGGCCAGTTGGGGGG - Intronic
1153741929 18:8138387-8138409 ACACAGAAGACAGGGTTGGAAGG - Intronic
1155996069 18:32332671-32332693 ACACAGCAGGGACAGTGTGGTGG - Intronic
1156345060 18:36249520-36249542 ACACAGAAGGAACAGTCTGGAGG + Intronic
1157320756 18:46632049-46632071 AAACAGAAGAGGCAGTGGGGAGG + Intronic
1157330225 18:46698633-46698655 ACCAAGAAGTGACAGGTGGGAGG - Intronic
1157934890 18:51861939-51861961 ACACAGAAAAGGCAGATGGGAGG + Intergenic
1159345462 18:67197675-67197697 ACACAGAAGACTGAGGTGGGAGG - Intergenic
1160138749 18:76298889-76298911 ACACACCAGAGACTGTTGTGTGG + Intergenic
1160843803 19:1157880-1157902 ACTCAGGAGAGAGAGCTGGGAGG - Intronic
1162641809 19:12016397-12016419 ACAGAGGAGAGACAGTTGAAAGG + Exonic
1163496493 19:17648993-17649015 TCACAGAAGAGGGAGTCGGGGGG + Intronic
1165784188 19:38451594-38451616 ACACAGAGGAGACAGATGACGGG + Intronic
1166276966 19:41760840-41760862 ACACAGAAAATACAGCTAGGGGG + Intronic
1166421724 19:42641482-42641504 ACTCAGAAGGGGGAGTTGGGAGG - Intronic
1166524152 19:43500743-43500765 ACTCAGAAGAGTGAGGTGGGAGG - Intronic
1166725140 19:45022314-45022336 ACCTAGAAGAGGCAGTGGGGAGG - Intronic
1166987634 19:46671055-46671077 ACACAGAGGAGAAAGTTGGCTGG + Intergenic
1167385155 19:49158503-49158525 ACATAGAAGAGACATCGGGGAGG - Intronic
1167825756 19:51971666-51971688 AGGCAAAAGAGATAGTTGGGGGG - Intronic
925139172 2:1537996-1538018 ACACAGTAGAGGGATTTGGGGGG - Intronic
925410892 2:3639464-3639486 ACACAGAGGAATCAGGTGGGTGG + Intronic
925522621 2:4764682-4764704 ACACACCAGGGGCAGTTGGGGGG + Intergenic
927219967 2:20697611-20697633 ACACTGAAGAGACTGTTTTGGGG - Intronic
927526123 2:23742536-23742558 ACACACCAGGGACAGTTGTGGGG + Intergenic
927923397 2:26991429-26991451 CCACAAAAGAAACAGTTTGGTGG + Intronic
928099331 2:28426447-28426469 ACACGGAGGAGACAGATGCGGGG - Intergenic
928143121 2:28748192-28748214 AGAGAGAAGAGAGAGTTGGTTGG + Intergenic
928254109 2:29707237-29707259 AGACAGAAGAGTAAGTGGGGAGG - Intronic
928638393 2:33271705-33271727 ACACAGAAAAGAAGGTTGGAGGG - Intronic
928954161 2:36844267-36844289 ACAATGAAGAGATAGTAGGGAGG + Exonic
929137452 2:38638057-38638079 AAAGAGAAGAGACAGGAGGGAGG + Intergenic
929602186 2:43211212-43211234 ACTCAGAACAGGCAGTGGGGAGG + Intergenic
929779006 2:44945776-44945798 AAAGAAAAGAGACAGTTGAGCGG - Exonic
931193948 2:60032716-60032738 TCACAGAAGAGACAGTTTCATGG + Intergenic
932052345 2:68411150-68411172 ACACACCAGAGCCTGTTGGGGGG + Intergenic
932454850 2:71843061-71843083 ACCCAGAAGAGAGAGGTAGGGGG + Intergenic
932842410 2:75095808-75095830 ACACAGAAGGGACAGGGGGATGG - Intronic
933236800 2:79873507-79873529 ACACAGCTTAGAAAGTTGGGTGG + Intronic
933439127 2:82287820-82287842 ATACAGAATGGACAGTTGAGTGG - Intergenic
934813501 2:97304652-97304674 ATACAGCAGAGAGAGTTGGCTGG + Intergenic
934824195 2:97403828-97403850 ATACAGCAGAGAGAGTTGGCTGG - Intergenic
935221505 2:101018734-101018756 ACACAAATGAGACAATTTGGAGG - Intronic
935231495 2:101101877-101101899 ACACACCAGAGCCTGTTGGGGGG + Intronic
935393833 2:102584475-102584497 AAACAGAAGAGCCACTTGTGAGG - Intergenic
937065046 2:119011522-119011544 ACTCAGAAGGGACAGAGGGGTGG - Intergenic
937230076 2:120393082-120393104 AGAAAGCAGAAACAGTTGGGTGG - Intergenic
937483081 2:122283072-122283094 ACACAGCGGAGACTGTTGTGGGG - Intergenic
937541053 2:122954239-122954261 ACACAGAGGAGACAGTTATCTGG - Intergenic
940001984 2:148975625-148975647 GAACAGAAGGGACAGCTGGGAGG - Intronic
940009072 2:149036643-149036665 GCACAGGAGAGAGAGTGGGGTGG + Intergenic
940019653 2:149143619-149143641 CCTCAGAAGAGACAATTGGAAGG - Intronic
940353360 2:152713783-152713805 TCACAGTAGTGACAGTTGGGAGG - Intronic
940381998 2:153025589-153025611 ACACAGGAGAGAAAGATAGGTGG - Intergenic
940432698 2:153611865-153611887 ACACATCAGGGACTGTTGGGGGG - Intergenic
941275991 2:163491406-163491428 ACACAGAAGAAAGAGCTGAGAGG - Intergenic
941325281 2:164106612-164106634 ACACAGCAAAGAAATTTGGGAGG + Intergenic
941339895 2:164294007-164294029 ACACACAGGAGCCTGTTGGGGGG + Intergenic
942406964 2:175666427-175666449 ATAAAGAAGATACAGATGGGAGG + Intergenic
942605619 2:177687265-177687287 AGACAGAAGCAACAGTTGGGAGG - Intronic
943308997 2:186303645-186303667 ACAGGGTAGAGAAAGTTGGGAGG - Intergenic
944518768 2:200541498-200541520 ACACAGAAAAGACACTAGGATGG - Intronic
946490415 2:220143993-220144015 ACATAAAAGAGTCAGATGGGTGG - Intergenic
946709036 2:222487677-222487699 TCACAGGAGAGACAGTCCGGTGG + Intronic
947982606 2:234423344-234423366 AGGCAGAAGAGACAGGTGGGCGG + Intergenic
1168763287 20:364461-364483 ACAGACAAAAGACAGTTTGGCGG + Intronic
1170004647 20:11652562-11652584 ACAGGGAAGAGAAAATTGGGAGG - Intergenic
1170868808 20:20185558-20185580 AGACAGGAAAGACAGCTGGGTGG + Intronic
1171427097 20:25056164-25056186 ACTCAGATAAGACAGTGGGGCGG - Intronic
1171430140 20:25077894-25077916 ACACAGAAGAGACAGTGAAGAGG + Intronic
1172897809 20:38312757-38312779 ACACTGAAAATACAGATGGGGGG + Intronic
1174244984 20:49172151-49172173 ACACAAATGTAACAGTTGGGAGG + Intronic
1175783462 20:61697893-61697915 AAAGAGAAGAAACAGATGGGAGG - Intronic
1180233361 21:46441682-46441704 ACACAGGATGGACAGATGGGTGG - Intronic
1180588304 22:16913699-16913721 ACACTGGAGAGACGGTTTGGTGG + Intergenic
1181993277 22:26854608-26854630 AGAAAGAAGAGAAATTTGGGAGG + Intergenic
1182193727 22:28492092-28492114 ACACACCAGAGACTGTTGTGGGG + Intronic
1182913702 22:34008780-34008802 GCACAGAGCAGACAGTGGGGAGG - Intergenic
1182921467 22:34084006-34084028 ACACAGAAGTGACACTTGCCAGG + Intergenic
1183304240 22:37073658-37073680 ACAGAGAGGGGACAGGTGGGAGG + Intronic
1183712800 22:39515568-39515590 ACACAGATAAGACAGAGGGGAGG + Exonic
1184549757 22:45198186-45198208 ACAGAGAAGAGAGAGATGAGGGG - Intronic
1185160000 22:49218629-49218651 AAATTGAAGAGACAGTTGTGTGG + Intergenic
1185264168 22:49889957-49889979 TCACTGAAGAGACAGTTCTGAGG - Exonic
1185281093 22:49970222-49970244 ACACGGAACAGACTGTTGAGGGG - Intergenic
949278372 3:2316051-2316073 ACAAGGATGAGACATTTGGGAGG - Intronic
949711958 3:6881300-6881322 ACACACTGGAGACTGTTGGGGGG - Intronic
950753145 3:15146831-15146853 AGACTGAAGGGACAGTTGGGTGG - Intergenic
951212936 3:19995325-19995347 ACAGAGTAGAGACACATGGGTGG + Intronic
952516688 3:34111857-34111879 ACACAGAACAGACATTTGATGGG - Intergenic
955011148 3:55015889-55015911 ACACAGAAGAGGCACGTGGTGGG - Intronic
955303401 3:57806216-57806238 ACACACCAGGGCCAGTTGGGGGG - Intronic
956203923 3:66736672-66736694 ACATAGCAGAGGCAGTAGGGAGG - Intergenic
956707629 3:72012918-72012940 AAACTGGAGAGACAGATGGGTGG + Intergenic
956974821 3:74567247-74567269 ACTCAGGAGGCACAGTTGGGAGG - Intergenic
957534131 3:81479099-81479121 AGACAAAAGAGGAAGTTGGGTGG - Intergenic
957882806 3:86243162-86243184 AGACACAAGAGACAGTTAGATGG + Intergenic
957950880 3:87124900-87124922 ACACATTAGAGACATTTGCGTGG - Intergenic
958196909 3:90253306-90253328 AAAGAGAAGAAAGAGTTGGGTGG + Intergenic
958253476 3:91297090-91297112 ACACACCAGGGACAGTTGTGAGG + Intergenic
959006944 3:101030329-101030351 ACACACCAGGGCCAGTTGGGGGG - Intergenic
959931269 3:111985791-111985813 AAAGCGAAGATACAGTTGGGAGG + Intronic
960022994 3:112976515-112976537 ACATAGAAGTGAAAGTTGGCCGG + Intergenic
960514178 3:118584874-118584896 ACACAGAAAAGGGAGTTGGAAGG - Intergenic
960953251 3:123013109-123013131 AGACACAGGAGAGAGTTGGGAGG + Intronic
961269038 3:125673742-125673764 CCAGAGAAGAGACAGGTGTGGGG + Intergenic
961761247 3:129169969-129169991 ACATAGAACATACAGTTGAGTGG - Intronic
962400715 3:135056752-135056774 TCGCAGACGAGACAGGTGGGAGG + Intronic
962456883 3:135573051-135573073 ACACACAAGAGAGCGTTGGAGGG + Intergenic
962879761 3:139565521-139565543 ACACAGTAGGGACTGTTGTGGGG - Intronic
963726331 3:148926032-148926054 AGCCAGAGCAGACAGTTGGGAGG - Intergenic
965095875 3:164225035-164225057 AGACAGTAGAGAGAGTAGGGTGG + Intergenic
965269193 3:166590312-166590334 ACACACCAGGGACTGTTGGGGGG + Intergenic
966756158 3:183373555-183373577 AGACAGAACAGACATTTGAGGGG - Intronic
967009765 3:185421777-185421799 ACAGTGAAGAGACTGTTAGGTGG - Intronic
967419035 3:189253204-189253226 ACACACTAGGGCCAGTTGGGGGG - Intronic
967998865 3:195187385-195187407 ACACAGAAGAGACAGTTGGGAGG - Intronic
968489171 4:880998-881020 ACACAGAAGACAAAGCTGGATGG + Intronic
968867503 4:3223010-3223032 TCACAGAAATGACAGTTTGGAGG + Intronic
968896694 4:3408430-3408452 ACACAGCAGAGCCAGGTGCGAGG - Intronic
969657944 4:8508831-8508853 ACACAGAAGAGACATTTGCTCGG - Intergenic
970679226 4:18488466-18488488 ACAGAGAAAAGACAGATAGGAGG - Intergenic
971059079 4:22946966-22946988 ACAGAAAAGAGAAAGTTGCGGGG + Intergenic
972681970 4:41315051-41315073 ACACACCAGAGCCTGTTGGGGGG + Intergenic
973025088 4:45259185-45259207 ACACACCAGAGACTGTTGTGGGG - Intergenic
973261897 4:48173564-48173586 CCACAGCAGAGGCTGTTGGGAGG + Intronic
975145145 4:70958706-70958728 ACACAGCAGAGAAAGTTTGTAGG + Intronic
977144160 4:93414487-93414509 AGACAGAAGAGACACTAGCGTGG - Intronic
977681403 4:99802082-99802104 ACACAGAAGTGGCAGTGAGGAGG - Intergenic
979026811 4:115587903-115587925 ACACAGCAGGGCAAGTTGGGGGG + Intergenic
979862394 4:125709599-125709621 AAATAGTAGAGACATTTGGGAGG + Intergenic
979922386 4:126515772-126515794 ACATAGAAGTGACACTTGGCTGG + Intergenic
980769852 4:137356865-137356887 ACACACCAGAGCCTGTTGGGGGG + Intergenic
980869545 4:138594993-138595015 CCACAGAAGGGACAGGTGAGGGG + Intergenic
982097039 4:151932725-151932747 ACACACAAGAAACAGCAGGGAGG - Intergenic
982847122 4:160268135-160268157 ACACACCAGAGACTGTTGTGGGG - Intergenic
982989609 4:162255407-162255429 ACTCAAAAAAGAGAGTTGGGGGG + Intergenic
984277779 4:177630939-177630961 AAACAGAGAAAACAGTTGGGTGG - Intergenic
985041305 4:185894245-185894267 ACACAGAAGAAAATGTTGGCAGG + Intronic
987266658 5:16262896-16262918 GCACAGAAGAGGAAGGTGGGCGG - Intergenic
987299541 5:16585249-16585271 AAACAGATAAGACAGTGGGGAGG + Intronic
987459000 5:18184104-18184126 ACACACCAGGGACTGTTGGGGGG - Intergenic
987965970 5:24872901-24872923 ACACATAAGAGATAGATGGATGG - Intergenic
989986293 5:50702813-50702835 ACACAGAAGAGGAAGTGGTGAGG + Intronic
990802289 5:59618642-59618664 ACACAGAGGATACAGTCAGGAGG + Intronic
990973136 5:61531609-61531631 ACACACAAGAGAAAGTTTGCCGG + Exonic
991078192 5:62565788-62565810 ACACACCAGGGCCAGTTGGGGGG - Intronic
991413403 5:66367212-66367234 AGAAAGCAGAGACAGTGGGGTGG + Intergenic
991539421 5:67709957-67709979 ACACACCAGGGACAGTTGTGGGG + Intergenic
992104970 5:73442903-73442925 ACTGAGAAGAGACATTTTGGGGG - Intergenic
993577353 5:89619192-89619214 ACACACTAGGGACTGTTGGGTGG - Intergenic
994742353 5:103636541-103636563 TCACAGAGGAGAAAGTTGGGGGG - Intergenic
995652273 5:114383229-114383251 ACACAGACTACACTGTTGGGAGG - Intronic
998350502 5:141497347-141497369 ACACATGAGAGGCAGTTGGTGGG - Intronic
998399720 5:141842426-141842448 ACACAGGAGAGGGATTTGGGGGG - Intergenic
998451099 5:142235428-142235450 ACACTGAAGATACTGTTGAGGGG + Intergenic
998818134 5:146033922-146033944 CAACAGAAGAGACAATTGGAAGG + Intronic
998824187 5:146084298-146084320 GAACAGTAGAGACAGTAGGGGGG + Intergenic
999230272 5:150057595-150057617 ACATAGGAGAGAGGGTTGGGGGG + Intronic
999834653 5:155356277-155356299 ACACACCAGAGACTGTTGTGGGG + Intergenic
999894997 5:156022933-156022955 ACAAAGAAGTGACAGCTGGGTGG - Intronic
1000463754 5:161550422-161550444 ACACACCAGAGCCTGTTGGGGGG - Intronic
1001894360 5:175365725-175365747 CCAGAGAAGAGACACTTGCGTGG + Intergenic
1002207355 5:177572684-177572706 ACACAGAAGACAGAGGTGGGAGG - Intergenic
1002411615 5:179083212-179083234 ACCTATAAGAGACATTTGGGGGG + Exonic
1002442923 5:179273698-179273720 GAGCAGGAGAGACAGTTGGGGGG - Intronic
1002902095 6:1417723-1417745 GCACAGAAGAGACGGTTAGGGGG - Intergenic
1003124986 6:3348927-3348949 ACGCTGGAGAGACAGTTGGAAGG - Intronic
1003714325 6:8629667-8629689 ATACAGAAGAGAGGGTGGGGAGG - Intergenic
1007375720 6:41455323-41455345 ACCTAGATGAGACAGTGGGGTGG + Intergenic
1009190998 6:60629952-60629974 ACACACCAGGGACAGTTGTGGGG - Intergenic
1009283150 6:61777120-61777142 ACACACCAGAGACTGTTGGGGGG + Intronic
1009721809 6:67481139-67481161 ACACACCAGGGACAGTTGTGGGG + Intergenic
1009794485 6:68450148-68450170 ACACACCAGAGCCTGTTGGGGGG - Intergenic
1009935016 6:70223884-70223906 AGAAAGAAGAGTCAGCTGGGAGG + Intronic
1010937996 6:81884521-81884543 ACACATCAGAGACTGTTGTGGGG - Intergenic
1011296265 6:85829534-85829556 ACACAGCAGGGACAGTTGTGGGG - Intergenic
1013962635 6:115918788-115918810 ACACAGAAGCAACAGATGGAAGG + Intergenic
1016476183 6:144431924-144431946 ACACACAAAAGACATTTTGGAGG - Intronic
1017271775 6:152515496-152515518 ACAAAGAAGAGCCAGTTGTCTGG - Intronic
1018005886 6:159621227-159621249 ACTCAGAATAGGCAGCTGGGTGG + Intergenic
1018062557 6:160102229-160102251 ACACAGAGGAGACAGGCAGGAGG - Intronic
1018647964 6:165965329-165965351 ACACAGAGGAGACACTGGTGGGG + Intronic
1019761466 7:2815778-2815800 ACACAGACGGGACTGTTGTGAGG - Intronic
1019835434 7:3378585-3378607 AAACAGAAGAGACAGCAGAGAGG - Intronic
1019900921 7:4020129-4020151 ACAAAGAAGGGTCAGGTGGGTGG - Intronic
1020908586 7:14098366-14098388 ACACAGAAAAGAGAGGTGGTAGG - Intergenic
1021393247 7:20120230-20120252 ACACAGAAGACAAGGTAGGGAGG + Intergenic
1021564804 7:22006633-22006655 AAAAAGAAGAGACATTTGGCTGG + Intergenic
1022346396 7:29518995-29519017 TCATAGAAGAGACAGTTAAGTGG - Intergenic
1023726299 7:43145797-43145819 ACACAGAAGATACAGAGGGTTGG - Intronic
1023888941 7:44379352-44379374 ACAGAGATGAGGCAGTTGGCGGG + Exonic
1024151738 7:46578596-46578618 ACACAGGAGAAGCAGTTCGGAGG + Intergenic
1024670950 7:51594168-51594190 ACACACAAGGGACTGTTGCGGGG - Intergenic
1025965545 7:66266888-66266910 ACACAAAAGAGACTGTTGAGGGG + Intronic
1028035712 7:85979130-85979152 ACTCAGAAGACAGAGGTGGGAGG + Intergenic
1028768823 7:94591644-94591666 CCACAGAAAGGTCAGTTGGGAGG - Intronic
1029837096 7:103323868-103323890 ACAAAGAAGAGATAGCAGGGCGG - Intronic
1029845707 7:103410318-103410340 ATACAGAAGAGAAGGTTGGGGGG + Intronic
1030494019 7:110274394-110274416 AAAAAGAAAAGACATTTGGGCGG + Intergenic
1030575542 7:111281548-111281570 ACCCAACAGAGACACTTGGGAGG + Intronic
1030636294 7:111953116-111953138 ACTCAGGAGACACAGGTGGGAGG + Intronic
1030918315 7:115345804-115345826 ATACAGAAGAGTCTGTGGGGTGG - Intergenic
1030921715 7:115397666-115397688 TCACTGGGGAGACAGTTGGGGGG + Intergenic
1031415867 7:121495738-121495760 GCACAGAAAAGAAAGTAGGGTGG + Intergenic
1032327263 7:130941580-130941602 ACACTGAAGACACACTTGTGAGG + Intergenic
1034052876 7:148001273-148001295 ACCCAGGAGACACAGTTGTGGGG - Intronic
1034447733 7:151122130-151122152 AGACAGAAGAGCCGGTTTGGGGG - Intronic
1034859371 7:154582795-154582817 ACACGGAAGAGTGAGTGGGGAGG - Intronic
1035810539 8:2487362-2487384 ACACAGATGAGACAGATGGATGG + Intergenic
1036188840 8:6650855-6650877 ACAGAGAAGAGACAGAAGGAAGG - Intergenic
1036241783 8:7087775-7087797 AGAAAGAAGAGAGAGATGGGAGG - Intergenic
1036556376 8:9863627-9863649 AGACAGAAGTGACAGTGGGGAGG - Intergenic
1037320066 8:17633304-17633326 ACTCAGAAGGCACAGGTGGGAGG + Intronic
1037915362 8:22769616-22769638 ACAGAGAAGAGGCATTCGGGTGG - Intronic
1037934510 8:22906166-22906188 ACACAGAAGTACCAGGTGGGAGG + Intronic
1039070905 8:33648539-33648561 ACACAGTAGAAAAAATTGGGAGG + Intergenic
1039440588 8:37592555-37592577 ACACAGAAGGGACAGGTGTTTGG + Intergenic
1039505125 8:38046471-38046493 ACTCAGGAGAGACACTTGGAAGG - Intronic
1041348336 8:56924155-56924177 AGAGGGAAGAGACATTTGGGAGG - Intergenic
1041736128 8:61112985-61113007 ATGCAGAAGTGATAGTTGGGAGG - Intronic
1041816915 8:61983791-61983813 ACAAAGAAGAGACAGATGATTGG + Intergenic
1042814611 8:72865001-72865023 ACACAGGTGAGACAGGTGGGAGG - Intronic
1043501769 8:80865402-80865424 ACAGAGAAGTAACAGTTGGGTGG + Intronic
1044039909 8:87354565-87354587 ACACACCAGGGACAGTTGTGGGG - Intronic
1044139789 8:88636315-88636337 ACACAGGAGAGACACCAGGGGGG + Intergenic
1044884862 8:96766297-96766319 ACACAGAGGAGACTTTTGGAGGG + Intronic
1045346362 8:101297444-101297466 AAAAAGAAGAGACAGTTCTGAGG + Intergenic
1046224354 8:111258844-111258866 ACTCAGAAGAGAGAGGTGAGTGG + Intergenic
1046465084 8:114590998-114591020 TAACAGAAGAGACTGTTGTGTGG + Intergenic
1046919422 8:119712370-119712392 ACTCAGAAGAGTGAGGTGGGAGG + Intergenic
1047069366 8:121325771-121325793 ACACAGAAGAGGCAGTTTGTGGG + Intergenic
1047285641 8:123485098-123485120 ACAAAGAAGACAAAGTAGGGTGG + Intergenic
1047529827 8:125664735-125664757 GCTCAGATGAGAGAGTTGGGAGG - Intergenic
1048278524 8:133087120-133087142 ACACGGAAGAGACATATTGGAGG + Intronic
1048817029 8:138343702-138343724 ACACAGTAGACACGTTTGGGAGG - Intronic
1048868412 8:138777527-138777549 ACACACAAGGGCCTGTTGGGGGG - Intronic
1050927922 9:11288863-11288885 ACACACCAGAGACTGTTGTGGGG + Intergenic
1051033824 9:12718600-12718622 ACACAGCAGAGACACTCAGGAGG - Intergenic
1052810713 9:33056623-33056645 ACCCAGAAGAGACATTTGAAAGG - Intronic
1054739410 9:68789495-68789517 ACACTTAAGAGACAGTGGTGAGG + Intronic
1054918396 9:70517573-70517595 ACTCAGAAGAGCGAGGTGGGAGG - Intergenic
1056223467 9:84472294-84472316 ACACAGAGGAGCCATTTGGATGG + Intergenic
1056697214 9:88869854-88869876 ACAAAGAATAGACACTTGAGGGG + Intergenic
1058024409 9:100125252-100125274 ACACTATAGAGACCGTTGGGAGG - Intronic
1058171778 9:101690100-101690122 GCTCAGAAGAGAGAGGTGGGAGG + Intronic
1059874614 9:118620515-118620537 AAACAGAGGTGAGAGTTGGGTGG - Intergenic
1062185026 9:135213533-135213555 AGGCAGCAGAGACATTTGGGTGG + Intergenic
1062231464 9:135484331-135484353 ACAGAGTGGAGAGAGTTGGGTGG - Intronic
1062271841 9:135713454-135713476 ACACAGGAGAGGCACTTGGTGGG + Intronic
1185471719 X:387545-387567 AAACAGTAGAGACAGGTTGGAGG + Intergenic
1187655984 X:21474338-21474360 ACTCAGAAGAGACACTGGGAAGG + Intronic
1188342829 X:29026397-29026419 ACACACCAGGGCCAGTTGGGTGG + Intronic
1188703326 X:33293335-33293357 AATAAGAAGAGACAGTTGAGAGG + Intronic
1189694455 X:43649800-43649822 ACACACCAGGGACAGTTGTGGGG - Intergenic
1190176307 X:48153203-48153225 ACACACAAGGGACTGTTGTGGGG + Intergenic
1191227392 X:58058210-58058232 ACACAGAACAGGGAGTTGGGGGG - Intergenic
1191879263 X:65828312-65828334 GCACAGAAGCCACAGTGGGGAGG + Intergenic
1192874188 X:75211012-75211034 ATCCAGATGAGACATTTGGGAGG + Intergenic
1193351357 X:80468535-80468557 ACACAGCAGGGCCTGTTGGGGGG + Intergenic
1193354662 X:80504141-80504163 ACACAGAAGAATCAGTTGATAGG + Intergenic
1193597668 X:83466736-83466758 ACACAGCAGGGCCTGTTGGGGGG - Intergenic
1194729312 X:97435488-97435510 ACACAAAGGAGAGAGGTGGGGGG - Intronic
1198661010 X:138967459-138967481 ACACAGAAGTCACAGGTGGCAGG + Intronic
1199944373 X:152653594-152653616 ACAGAGAAGAGCCAGGTTGGGGG + Exonic